1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ainat [17]
3 years ago
12

How is the absorption of ultraviolet light by DNA and RNA important in the analysis of nucleic acids? A. Nucleic acids absord UV

licht maximaly at wavelengths of 247 to 250 m Using this phenomenon one can oftendermine the presence and concentration of nucleic acids in a mixture, since proteins absorb UV light maximally a 200 m B. Nucleic acids absorb UV light maximaly at wavelengths of 254 to 260 proteins absorb UV maximally at 200 mm m. Using this phenomenon, one can to determine the presence and concentration of nucleic acids in a mixture, since C. Nucleic acids absorb UV light maximalyal Wavelengths of 254 to 280 nm. Using this phenomenon one can hen determine the presence and concentration of nucleic acids in a since proteins absorb UV light maximally at 270 mm D. Nucleic acids absorb UV light maximally at wavelengths of 247 10 250 nm. Using this phenomenon, one can often farmine the presence and concentration of nucleic acids in a mixture, since proteins absorb UV light maximally at 270 nm
Biology
1 answer:
qaws [65]3 years ago
3 0

Answer:

B. Nucleic acids absorb UV light maximally at wavelengths of 254 to 260. Proteins absorb UV maximally at 200 nm. Using this phenomenon, one can to determine the presence and concentration of nucleic acids in a mixture.

Explanation:

The concentration of a solution of nucleic acid  can be determined by measuring the absorbance at 260 nm, using a  spectrophotometer. An A260 of 1.0 is equivalent to a concentration of 50 μg/mL for double-stranded DNA, or 40 μg/mL for single-stranded DNA or RNA. If the A280 is also determined, the A260/A280  ratio indicates if there are contaminants present, such as residual  phenol or protein. <u>The A260/A280 ratio should be around 1.8 for pure  DNA and 2.0 for pure RNA preparations.</u>

You might be interested in
Please select all that apply​
Rzqust [24]

Answer:

Cell renewal, growth, and asexual reproduction :)

Explanation:

7 0
3 years ago
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
191 Составьте синквейн к слову подарок​
nordsb [41]

"синквейн". Считается, что это стимулирует умственную деятельность учащихся, способствует развитию творческого мышления, навыков письма и чтения, умения анализировать и делать выводы, формулируя их кратко. Кроме того, очень интересно составлять синквейны, и дети с удовольствием этим занимаются.

Что такое Синквин?

Эта форма стихосложения возникла по предложению американской Аделаиды Крапси в начале прошлого века, благодаря восточным принципам поэзии - хайку и танка. В результате получился синквейн - лаконичная пятистрочная поэтическая форма, несущая синтезированную информацию. Синквейн делится на несколько разновидностей, каждая из которых имеет определенные правила составления.

мое слово присутствует!

6 0
3 years ago
Question 2 of 10
adelina 88 [10]
Option C is the correct answer.
8 0
4 years ago
During crossing over in meiosis, an incomplete exchange of genetic material occurs. this would most likely produce
Leona [35]
<span>During crossing over in meiosis </span>an incomplete exchange of genetic material occurs. This would most likely produce,a deficiency in one homologue and a duplication in the other homologue
5 0
4 years ago
Other questions:
  • I need help with questions please
    10·1 answer
  • Each of the following is an abiotic factor in the environment except
    14·1 answer
  • 3. Climate change (an abiotic factor) has slowly decreased habitat for the arctic seals. Predict how a reduction in habitat coul
    9·1 answer
  • What is the original source of energy for most living organisms?
    6·1 answer
  • Which of the following describes prokarotes
    12·1 answer
  • The use of non-local resources is associated with certain economic and environmental consequences.
    7·2 answers
  • Without helicase, predict what would happen during DNA replication
    5·1 answer
  • 17. Why did cover crops fall out of favor in the 20th century?
    5·1 answer
  • Usueueyegryyd ebejjsudbdd dheieyyehe
    15·2 answers
  • What documented examples from real-life organ donors can you provide to help you demonstrate how a regulated human organ trade w
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!