1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Radda [10]
3 years ago
7

I neeed help plz asap

Biology
2 answers:
Svetach [21]3 years ago
8 0

Answer:

C is definitely your answer

Delvig [45]3 years ago
7 0
C is the correct answer
You might be interested in
Science has nothing to do with
maria [59]

Answer:

anything

Explanation:

please report me

5 0
3 years ago
Read 2 more answers
A. organs type answer here
Ket [755]
Caudal type answer here
4 0
3 years ago
a blank reaction occurs when ionic or comment bond are broken and elements ions or simpler molecules are formed
BaLLatris [955]
A decomposition reaction occurs when ionic or covalent bonds are broken and elements and or ions or simpler molecules are formed.
8 0
3 years ago
What was the work of Rudolf Virchow trying to prove?
Aleksandr-060686 [28]
The answer is letter C. That spontaneous generation didn't happe

Rudolf Virchow tried to prove that whatever cells existed had to come from pre-existing ones.

<span>Thank you for posting your question. I hope you found what you were after. Please feel free to ask me more.</span>

7 0
4 years ago
Read 2 more answers
Which of the following correctly shows the sequence of protein synthesis?
Goryan [66]

Answer:

D

Explanation:

*too lazy to write the explanation*

3 0
3 years ago
Other questions:
  • A rapid mechanism is thought to govern the localization of AQP5 in response to changes in extracellular osmolarity. If this mech
    9·1 answer
  • Which class level is honey bees
    13·1 answer
  • Match the computer discipline with its description? Focuses on developing software that is reliable, efficient, affordable, user
    5·1 answer
  • What is the anatomy of a flower?
    9·1 answer
  • The amino acids in bacteria and plants can be classified in families based on the precursor molecule in the synthesis pathway of
    14·1 answer
  • Chain Pickerel is a freshwater fish that is a member of the pike family. Chain Pickerels are found along the Eastern coast of an
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which food group is shown in the picture below?
    12·2 answers
  • Are environmental factors more likely to affect genotype or phenotype?
    13·1 answer
  • 2. A car salesperson claims that a 300-hp engine is a necessary option in a compact car, in place of the conventioNl 130-hp engi
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!