1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ipn [44]
3 years ago
7

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Biology
1 answer:
tino4ka555 [31]3 years ago
3 0

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

You might be interested in
19. Why are biologists uncertain about how many species are living on Earth?
VladimirAG [237]

Answer: It is bc we as human kind find many different living things on earth every day in both things such as animals to bacteria.

7 0
3 years ago
The form of asexual reproduction.
Tom [10]

Answer:

There are a number of types of asexual reproduction including fission, fragmentation, budding, vegetative reproduction, spore formation and agamogenesis. ... In multiple fission (right), a multinucleated cell can divide to form more than one daughter cell. Multiple fission is more often observed among protists

Explanation:

5 0
3 years ago
Read 2 more answers
Cuanto centímetros de ve medir el pene, para complacer a una mujer?
amm1812
El average es 6 centimetros cuando esta ¨happy¨. el average sera sufficiente pero cuenta mas la experiencia 
7 0
3 years ago
Read 2 more answers
Joe wants to know if birds prefer to eat in one
bixtya [17]

Answer:

the answer is B, the location of the bird feeders

8 0
3 years ago
Select the true statements about the electron transport chain.
almond37 [142]

Answer: A. In the electron transport chain, a series of reactions move electrons through carriers.

B. The products of the electron transport chain are H2O and either NAD or FAD.

E. The electron transport chain is a series of oxidation-reduction reactions that occur in the inner mitochondrial membrane.

Explanation:

the best suitable statement is it transfers energy stepwise from one compound to another, The electron transport chain is a series of proteins and organic molecules found in the inner membrane of the mitochondria. Electrons are transferred from one member of the transport chain to another in a series of redox reactions.

5 0
4 years ago
Read 2 more answers
Other questions:
  • A blood pressure of 60 over 80 would indicate that a patient had…
    15·2 answers
  • A new process for removing heavy metals and acid sulfate pollution from mine leachate water is ________. treatment with chlorine
    11·1 answer
  • What is not true about ionic bonds? They have low melting points, they conduct electric current when dissolved in water, they fo
    7·1 answer
  • The basement membrane consists of __________ secreted by __________.
    9·1 answer
  • The diagram shows how a plant grew after being turned on its side.
    14·2 answers
  • Suppose we have one true-breeding strain of tomato that produces red fruit. Suppose we also have a true-breeding strain of tomat
    5·1 answer
  • If transpiration didn't take place, would water be able to enter the roots of the plant? Explain your reasoning
    11·1 answer
  • Question 1 Multiple Choice Worth 4 points)
    15·1 answer
  • Pioneer species are species that colonize previously uncolonized land, usually leading
    8·1 answer
  • Sherri is sliding down a slide at a playground. When is Sherri's potential energy the greatest?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!