1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ipn [44]
3 years ago
7

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Biology
1 answer:
tino4ka555 [31]3 years ago
3 0

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

You might be interested in
CORRECT + BEST EXPLANATION GETS BRAINLIEST
katrin2010 [14]

B. It provides information about why certain measurements are made in an experiment

From experience, to be able to have background research helps in the design of an experiment because it would tell you what is being measured in a experiment. Without the background information, my whole class got lost on what to do until my teacher told us what we had to measure and how we could measure the experiment.

8 0
3 years ago
Read 2 more answers
1. Primary producers include plants, algae, and cyanobacteria. The amount of biomass produced
slava [35]

Answer:

Explanation:

Tropical Rain forest -> Temperate Forest -> Taiga -> Tundra

4 0
3 years ago
What molecule can mix with water and it also a source of energy and a storage area?
Delvig [45]

Answer:Lipids are organic molecules which can be used for long-term energy. These includes fats, waxes, sterols, glycerides, phospholipids, etc. Lipids contain more energy per unit mass which makes it much lighter. However, their insolubility to water makes them harder to transport.

Explanation:

4 0
3 years ago
Read 2 more answers
What are some pros of being a seismologist rather than being a volcanologist?
slega [8]
What are the answers given?
3 0
4 years ago
Ligers are the largest cat in the world that is a mix between a lion and a tiger. This is an example of..
Aleksandr-060686 [28]

Answer:

Cross breeding

Explanation:

8 0
4 years ago
Other questions:
  • true breeding plant with green seed is crossed with true breeding plant with yellow seed with yellow being dominate. What color
    11·1 answer
  • Studies of embryos of various species have shown a series of genes that
    7·1 answer
  • A client presents to the ed reporting anxiety and chest pain after shoveling heavy snow that morning. the client says that nitro
    11·1 answer
  • The unequal heating of Earth occurs because at the_____, more solar energy is received than is radiated back to space, and at th
    12·1 answer
  • When our sun is formed and what is happening in it right now.
    14·1 answer
  • A scientist finds a gene in the DNA of a wild-growing plant that could increase the amount of lycopene, a cancer-fighting agent,
    14·2 answers
  • Which of the following processes would have the quickest impact on the shape of beaches?
    8·1 answer
  • Exocytosis is a type of cellular transport that allows materials to move across the plasma membrane of a cell. Which of the stat
    9·2 answers
  • What number of President was Andrew Johnson
    11·1 answer
  • HELP!! 20 POINTS!!
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!