1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nadusha1986 [10]
3 years ago
14

A. how is each target selectively toxic to kill microbes without harming the host?

Biology
1 answer:
finlep [7]3 years ago
6 0
- Bacteria are encased in a cell wall, if they didn't have on they would absorb water, swell and burst
- Penicillin's and cephalosporin's weaken cell wall and cause lysis, since mammalian cells have no cell wall these drugs do not affect them
You might be interested in
I just need the right words for each place. (8-10)​
uysha [10]
8. Glucose
9. NADH
10. 2 Pyruvic Acid
8 0
2 years ago
No two species can occupy the same niche in the same habitat at the same time
Alecsey [184]
The answer is b hope it help
3 0
2 years ago
How do viruses compare with organism
Masja [62]
A virus is bacterial. It has cells but it isn’t a living thing so to speak.


An organism is a number of tissues (organs) working together. It has a conciseness, and also has cells.
8 0
3 years ago
Read 2 more answers
Make a pedigree for left-handedness using information of the Thomas family:
Vilka [71]

Answer: You will find the pedigree in the attached files

First-generation (Parents):  

• Tom: rr

• Diane: Rr

Second generation (Children):

• Anna: rr

• Anna´s husband: Rr

• Mary: Rr

• Mary´s husband: RR, Rr, or rr

• Teddy: Rr  

Third generation (Grandchildren):

• Will: Rr

• Vanessa: rr

• Patric: RR or Rr

Explanation:

Due to technical problems, you will find the complete answer and explanation in the attached files

6 0
2 years ago
Which of the following statements describes how tissues, organs, and organ systems are related?
Anton [14]
I think the answer is c.
7 0
3 years ago
Read 2 more answers
Other questions:
  • What property of and object can you determine using mass and volume
    15·2 answers
  • In the human body, oxygen is absorbed by the lungs and nutrients are absorbed by the small intestine. In a single-celled organis
    6·2 answers
  • What condition causes storms to occur
    6·2 answers
  • Why does using two different enzymes to cut the plasmid prevent the plasmid from reforming a circle without the inserted gene?
    6·1 answer
  • When an organic compost pile is built correctly (sufficiently large, slightly moist, and containing a variety of organic materia
    9·2 answers
  • Gustatory hairs are to taste as olfactory hairs are to? select one:
    12·2 answers
  • When an earthquake occurs engery radiates in all directions from its source which is called?
    5·1 answer
  • What is the main energy providing molecules in living things
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How does the electromagnetic spectrum arrange different types of radiation?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!