1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
schepotkina [342]
3 years ago
9

Using the graphic provided, identify the products if photosynthesis.

Biology
2 answers:
Zigmanuir [339]3 years ago
7 0

Answer:

b

Explanation:

The reactants are sunlight, water and carbon dioxide and the products are oxygen are sugar.

IceJOKER [234]3 years ago
7 0

Answer:

B

Explanation:

The reaction for photosynthesis is

6CO2 + 6H2O -----> C6H12O6 + 6O2

|--> this is sugar (glucose)

You might be interested in
A protein helps transport a neutral substance from a region of higher concentration to a region of lower concentration. The tran
LuckyWell [14K]

Answer: The correct answer is option C

FACILITATED DIFFUSION.

Explanation: FACILITATED DIFFUSION is a form of passive transport,it is the process by which substances(molecules) move from a region of higher concentration to a region if lower concentration along their concentration gradient through the help of a membrane transporter forming a pore or channel(Protein).

Facilitated diffusion dies not require high energy to occur since a concentration gradient is involved.

3 0
3 years ago
Read 2 more answers
A pure culture in the exponential growth phase has a bacterial concentration of 6.4 x 108 cells/ml. If the bacterium has a gener
finlep [7]

Answer:

856

Explanation:

5 0
3 years ago
A human zygote is produced from two gametes that are identical in________
Cerrena [4.2K]

Answer:

C

Hope its helps

Correct me if im wrong

6 0
2 years ago
What is the job of vacuoles in animal cells? Explain.<br><br> Thank you :)
natka813 [3]

Answer:

Vacuole. A vacuole is a membrane-bound cell organelle. In animal cells, vacuoles are generally small and help sequester waste products. In plant cells, vacuoles help maintain water balance.

Explanation:

7 0
4 years ago
Read 2 more answers
Which of the following pairs of protists and their ecological roles are correctly matched?
melisa1 [442]

Answer:

The correct pair is A: "apicomplexans—parasites of animals"

Explanation:

  • Euglenophyta is a group of unicellular, eukaryotic organisms. They are small, free-living forms, or parasites that present different feeding mechanisms and behaviors, such as heterotrophy, autotrophy, or mixotrophy.
  • Dinoflagellates are unicellular, flagellated, free-living protists that might form colonies. Most of them are autotrophic organisms but some of them are heterotrophic, or mixotrophic. In these last cases, dinoflagellates can feed on other dinoflagellates, protozoans, or diatoms. They can also be parasites.
  • Entamoebas are endoparasitic organisms with no mitochondria as an adaptation of living in environments with low oxygen concentration.
  • Apicomplexa is a unicellular, protist group. They have medical and economic importance as they are<u> animals</u> and human parasites. They have an apical complex that helps them to fixate to the host cell and release a substance that provokes an invagination in the host membrane. This invagination allows the parasite to get into the host cell.
5 0
3 years ago
Other questions:
  • Which color bends more blue red or green
    13·1 answer
  • After studying the fossils of woolly mammoths and comparing them to the bones of modern-day elephants, Georges Cuvier proposed s
    13·2 answers
  • 3 4 5 6 7 8 9 10 TIME REMAINING 01:47:17 Some tools have graduations to show multiple measurements. For example, a ruler may hav
    6·1 answer
  • Dessert are only found near the equator t or f
    5·1 answer
  • What is the relationship between the greenhouse effect and global warming
    7·2 answers
  • Hypertonic solutions have ______ water potential.
    5·2 answers
  • What is the order in which sound waves travel through the ear?
    11·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What ball likely has more kinetic energy when in motion a billiards ball bowling ball? HELP PLZZ!!​
    11·2 answers
  • Assertion (A): A proton gradient cannot be established in the mitochondria.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!