1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]2 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
Which shows the correct order of processes the body undergoes to maintain blood glucose levels?
Lostsunrise [7]
The correct option is D.
The insulin and the glucagon hormone work together to keep the blood glucose level in the narrow range that is optimum for the health of the body. The glucagon hormone is responsible for increasing the blood glucose level when its concentration is dropping below normal while the insulin hormone is responsible for lowering the blood glucose level when its concentration is above the normal level.
8 0
3 years ago
What does it mean to analyze data?
sertanlavr [38]
To look over something, find details
7 0
3 years ago
What is an organelle? give two examples of organelles that can be found within a cell
kherson [118]
An organelle is a function in the body. 


4 0
3 years ago
Read 2 more answers
The Scientific Metho
Xelga [282]

Answer:

a.)

Explanation:

8 0
2 years ago
Which of the following examples is an endothermic process? Which of the following examples is an endothermic process? Heat is ne
pychu [463]
<h2>Endothermic Process</h2>

Explanation:

An example of endothermic process is :

Heat is needed for water to boil.

Endothermic process can be defined as a process in which heat energy is absorbed from the surrounding that bring about changes in the molecular level like breaking chemical bonds, inter-molecular force of attraction etc.

Boiling of water is an endothermic process because during this process water absorbs heat , its kinetic energy increases and then it boils.

3 0
3 years ago
Other questions:
  • A client with leukemia is being discharged from the hospital. after hearing the nurse's instructions to keep regularly scheduled
    9·1 answer
  • Match the following items. 1. semipermeable; allows certain substances to pass through plasma membrane 2. controls activities of
    13·2 answers
  • Giving brainliest answer quicklyyy
    7·2 answers
  • A scientist asked a question that was based on an observation. Which is the next step the scientist should take?
    10·1 answer
  • If you can easily see the different parts that make up a mixture, you know that it is a __________ mixture. * answer
    15·1 answer
  • What is the term for all of the population in a particular region
    15·2 answers
  • What is the chemical mechanism by which cells make polymers from monomers?
    10·1 answer
  • Explain why cells don't just continue to grow larger as organisms grow larger. Why do cells divide?
    8·1 answer
  • What is recombinant plasmid
    14·1 answer
  • Describe how the bones, muscles, and sensory organs all work together.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!