1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
3 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]3 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
Identify the changes as either chemical (C) or physical (P). If chemical, what is the evidence?
Strike441 [17]

Answer:

1). P

2 C

3 P

4 P

5. P

Explanation:

THSE Answer are right a

6 0
3 years ago
The attraction of dissimilar molecules to each other illustrates
aleksley [76]
<span>the force that causes the molecules on the surface of a liquid to be pushed together and form a layer
</span><span>


surface tension 

SURFACE TENSION 

VERY SIMPLE!! 

PLEASE MARK BRAINLIEST





</span>
8 0
3 years ago
Suppose that over seeveral years, the climate in an area becomes much drier than it was before.How would plants, like the ones s
navik [9.2K]
So in this scenario, we have to consider two things: the plants are super different from each other. Some plants have huge leaves, others have tiny ones-- some plants have really long roots, others barely have them; it is because of these differences that the some plants survive better than others. 

Say that at the start, plants are thriving like crazy-- I mean they're everywhere man. 

But afterwards, this huge environmental change occurs. 

Plants that have bigger leaves lose more water due to a greater rate of transpiration. Plants with shorter roots can't reach the water deep in the soil. 
Plants with smaller leaves, and waxier cuticles could protect their water more. Plants with longer roots could get more water. 

Basically, all plants that have good traits for drier environments tend to survive more.

Because they tend to survive more-- they could make more baby plants (i.e. greater rate of reproduction)

Because they could make more baby plants, the overall newer generation of plants will have more of these hardy, dry-environment adapted plant traits (i.e. phenotype). 
7 0
3 years ago
Why are mitochondria bigger in animal cells
Greeley [361]
When you think about the main purpose of mitochondira (to produce energy; an easy idea how to remember the function of mitochondria in our bodies is to imagine them as energy factories or power plants) it becomes easy to understand why.

Animals (including us) move a lot more compared to plants. For movement you need energy and energy needs to be produced in our bodies in order for us to be able to move. Therefore, we have mitochondria that are bigger. Not only that, animal cells usually also have more mitochondria. All of this is probably done to keep up with the increased energy demands that moving organisms have. 
5 0
3 years ago
You can make a scary face by grabbing your bottom lip with your top teeth. When you do this, your mandible moves in an anterior
saw5 [17]

Answer:

Retraction.

Explanation:

When someone suffers from lower eyelid retraction, it means that their lower eyelid has actually been pulled downward which is an example of a scary face.

Another example is by grabbing your bottom lip with your top teeth. When you do this, your mandible moves in an anterior direction.

5 0
3 years ago
Other questions:
  • what can carbon atoms do that makes them different from atoms of the five other common element of life
    11·1 answer
  • Stereopsis is the ablility to associate music with vision TRUE OR FALSE
    8·2 answers
  • Second-generation antipsychotic drugs bind to dopamine receptors and _____ receptors
    9·2 answers
  • Lola has a condition where mucus builds up in her lungs.this makes it more difficult for gas exchange to take place , which two
    9·2 answers
  • 18. in a traditional taxonomic system, a kingdom made up of all prokaryotes except members of the kingdom
    14·1 answer
  • (NEED HELP ASAP) True or False: Some food molecules (fiber, starch, glucose,etc.) that enter the body never leave the digestive
    10·1 answer
  • The cell in the diagram below illustrates a stage of mitotic cell division.
    6·1 answer
  • What are the main processes of the nitrogen cycle and what do they each do/accomplish
    8·2 answers
  • Learning Task 3
    15·1 answer
  • efferent vagal fibre stimulation blunts nuclear factor-kappab activation and protects against hypovolemic hemorrhagic shock""
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!