1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
3 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]3 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
Respiration in echinoderms​
choli [55]
In general, echinoderms typically respire by simple diffusion, using gills or specialized projections, like tube feet or pockets, to circulate water and oxygen through their bodies. Many echinoderms also use a simple hemal system, a series of pockets and tubes that serves almost like a net of veins and arteries.
8 0
3 years ago
What are two mammals that pollinate plants?
mrs_skeptik [129]

two mammals that pollinate plants are bats and monkeys!

<em>hope this helps</em>

5 0
4 years ago
What is the principle called the conversation of matter
Nastasia [14]
the conservation of matter is when matter cannot be created or destroyed.
4 0
3 years ago
True or false. 1. Your respiratory system is the system in your body that is responsible for breathing.
Mice21 [21]
<span>1.Your respiratory system is the system in your body that is responsible for breathing. TRUE 
</span><span>2.The lungs are made up of thick fibrous tissue. FALSE
</span><span>3. Internal respiration takes place in the alveoli.  FALSE
</span>4.<span>The alveoli are located at the end of the bronchi. FALSE
</span><span>5. The hemoglobin in blood combines with oxygen when the blood flows through areas where oxygen concentration is high. TRUE
</span>6. <span>Marijuana does not contain carcinogens. FALSE
</span><span>7. It is more difficult to stop smoking cigarettes if you use marijuana  regularly. TRUE
</span><span>8. It takes as long as 3 days for the body to eliminate the chemical effect that marijuana has on the body. FALSE
 9. The drug THC acts as a stimulant and can improve strength, balance, and coordination. FALSE
 10. People who quit smoking usually cannot reverse the adverse affects caused by cigarettes. FALSE</span>
3 0
3 years ago
Read 2 more answers
Once inside the erythrocyte, the merozoite enlarges and becomes a ring trophozoite. The trophozoite's nucleus divides asexually
ohaa [14]

Answer:

im pretty sure its mitosis

Explanation:

7 0
3 years ago
Other questions:
  • Which is a quantitative method of data collection?
    11·1 answer
  • Desertification is caused by
    14·1 answer
  • Which is true of mitosis?
    15·2 answers
  • in the energy pyramid, an organism that eats the secondary consumer is called a ______ plz I need help on this
    8·1 answer
  • Climate in a given region can be considered an average of that region's daily weather. true or false
    6·1 answer
  • Examine the situation. Gregor Mendel wondered how traits were inherited, but the technology to study genes was unknown. By cross
    9·1 answer
  • Describe what happens during cytokinesis in animal cells.
    5·1 answer
  • Geologists use and fossils to infer what the environment of a place was like when a layer of it was forming.
    7·1 answer
  • How are photosynthesis and cellular respiration different?
    15·1 answer
  • What function(s) are plant cells able to complete that animal cells cannot? What organelle(s) are involved?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!