1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]2 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
Where do subduction zones often occur?
kupik [55]
D: Where two continental plates are colliding, creating a convergent boundary. One plate slips under the other because of convection currents in the mantle.
3 0
3 years ago
Read 2 more answers
What component of the cell wall helps in growth and development, as well as keeping it strong to defend itself?
Ratling [72]

Answer: Option C.

Cellulose.

Explanation:

Cellulose is a polysaccharide which is made up of glucose and it is an important component in plant cell wall. It give strength and rigidity to the cell wall. Cellulose make the cell walls strong. This play a regulatory role in tissues growth and provide strength. The cellulose is only found in cell wall and it's protect the cell wall.

8 0
3 years ago
Help plz thoinksjgfydrtdxfgtu
ololo11 [35]

Answer:

Well, we actually evolved from a single cell organism. BUT, in this case it is

answer  B

Explanation:

5 0
3 years ago
Read 2 more answers
How were cells discovered
ozzi

Answer:

The cell was first discovered by Robert Hooke in 1665 using a microscope. The first cell theory is credited to the work of Theodor Schwann and Matthias Jakob Schleiden in the 1830s.

8 0
3 years ago
Lysosomes can be compared to the recycling and garbage centers of a city. How can this comparison be justified? A; They break do
Nitella [24]
I think C. They break down and digest whole cells
Hope this helped
3 0
3 years ago
Read 2 more answers
Other questions:
  • Both the sympathetic and parasympathetic divisions can be found in the __________ nervous system. A. central B. autonomic C. som
    5·2 answers
  • How is a bacteroid distinguished from a bacterial cell?
    11·1 answer
  • The area of the specimen when looking through the microscope is the
    12·1 answer
  • When blood flows into the right atrium from the body it contains
    13·2 answers
  • How do you write this dichotomous key?
    5·1 answer
  • Es un organulo de la celula encargada de la sintesis de proteina​
    11·1 answer
  • The segments of DNA that we call genes usually code for proteins. The region of
    11·1 answer
  • 50 POINTS AND BRAINIEST <br> what happens if public libraries do not obey the federal law?
    6·2 answers
  • Can somebody help me please
    11·2 answers
  • I need someone to write me an essay, please. Describe the different types of cellular transport and explain how the structure of
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!