1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]2 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
Black panthers eat other animals in their ecosystem, including deer, fish, birds, and rabbits. Which of the following terms best
Sladkaya [172]

Answer:

The best term that would describe the Black Panther is a predator

6 0
3 years ago
The science of classifying organisms is​
Luda [366]

Answer:

<u><em>Taxonomy</em></u>

<u><em>Taxonomy</em></u> is the science of <u><em>naming, describing and classifying organisms</em></u> and includes all plants, animals and microorganisms of the world

                              Have a good morning, afternoon, or night!

                                                ~Dreamer1331~

*Please mark brainliest when possible and if you feel i deserve it, thank you!*

6 0
2 years ago
Read 2 more answers
#15. what is the end-replication problem? why, in the absence of telomerase, do the ends of the linear chromosomes get progressi
noname [10]

The DNA replication by the action of DNA polymerase takes place in the 3' to 5' direction on the leading strand. The lagging strand which has the opposite orientation or polarity as that of the leading strand requires a more time to get synthesised. The DNA replication of the lagging strand happens in short segments where a RNA primer forms a compliment with a part of the DNA segment on its 3' end. This RNA primer helps initiate the replication of the Okazaki fragments. When the replication on the lagging strand reaches its end, the RNA primer forms a compliment with the last bit of the strand. This small segment gets missed in the end as no more DNA is left to form a RNA primer-DNA compliment. Such shortening of the lagging strand in the replication process is the end-replication problem.

Telomeres are protective ends of the DNA strands. These ends contain a poly-A tail. When the lagging strand replication reaches its end, the RNA primer forms a compliment with the telomere and initiates the replication. This leads to the shortening of the telomere and not the coding segments on the lagging strand of DNA. The telomerase repairs the shortened telomere by re-synthesising it.

7 0
3 years ago
The most electronegative atoms typically present in biological molecules are ____ and ____.
Lapatulllka [165]
<span>The most electronegative atoms typically present in biological molecules are O and N.
Hope this helps

</span>
3 0
3 years ago
Is a scientific hypothesis accepted if there is no way to demonstrate that the hypothesis is wrong? Please explain your answer.
sveticcg [70]
It is accepted to be fact by those who accept it to be fact, until further experimentation or research can prove otherwise
4 0
3 years ago
Read 2 more answers
Other questions:
  • Typically best practices would dictate that a guest account would be placed in a(n) __________, isolated from the production net
    14·1 answer
  • How do drugs of abuse affect the brain?
    10·2 answers
  • Which option accurately describes the first two stages of photo synthesis
    6·1 answer
  • What structure is located between the trachea and a bronchiole?
    8·1 answer
  • In chickens, congenital baldness results from a Z-linked recessive gene. A bald rooster is mated with a normal hen. The Fi from
    7·1 answer
  • How is the information in a DNA molecule expressed?
    8·2 answers
  • Why is bacteria good for copying large amounts of DNA?
    11·2 answers
  • I need help to get the right question because i got it wrong
    7·1 answer
  • Write which organism from the images fits each of the following descriptions.
    9·1 answer
  • 2. Describe three conditioned reflexes that you exhibit while at school.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!