1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
3 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]3 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
What helps nausea during pregnancy first trimester
klemol [59]

Answer:

pregnancy lollipops

Explanation:

6 0
3 years ago
What does the acid test tell you about a mineral?
Zolol [24]

I would go with C because it’s the only that makes any logical sense. All the others except B are fillers

4 0
3 years ago
Read 2 more answers
Which of the following describes acceleration? A. Acceleration cannot be described with a negative number. B. Acceleration is a
Ainat [17]

The answer would be:

<u><em>B. Acceleration is a vector quantity.</em></u>

We can rule out the others because:

---Acceleration CAN be described with a negative number. The sign actually shows the direction. A negative number indicates a deceleration.

---Displacement change over time is the definition of velocity NOT acceleration.

---The SI unit for acceleration is m/s².

***A <em>vector quantity</em> is measure of <u>magnitude</u> and <u>direction</u>, which acceleration has.

6 0
4 years ago
Read 2 more answers
During what stage of the cell cycle is DNA copied?
BartSMP [9]
DNA isn't really copied, it's more so split into 2 parts.

DNA is split into 2 parts during mitosis, more exactly the 5th stage called anaphase. chromosomes, which hold DNA< are split into 2 (genetically identical) groups, and each respective group goes to one spindle or another, readying for the last phase of mitosis and eventually cytokinesis.
7 0
3 years ago
What happened when the rabbit caught his head in a fan?
iren [92.7K]

When the rabbit caught his head in a fan means that it took ears off his own life. It may be related to a person who might possibly living by his/her own means. That person may be independent in his own way to the point that he/she may not listen to the opinion of others.

4 0
3 years ago
Other questions:
  • Some organisms undergo asexual reproduction through mitosis, while others reproduce sexually, and their cells undergo meiosis to
    12·2 answers
  • What is unusual about mitochondrial DNA?
    5·1 answer
  • Climax communities __________________communities that are undergoing primary succession.
    12·1 answer
  • In the boxes, write the number of crickets you would test to make this a controlled experiment
    13·2 answers
  • Suppose you remove your test cultures from the incubator and notice that one of them—a known fermenter—has a gas bubble in the D
    15·1 answer
  • Which of the following is NOT one of the primary layers of the atmosphere?
    11·2 answers
  • What is biological nitrogen fixation​
    6·1 answer
  • Mapa mental sobre El origen de las especies
    7·1 answer
  • NEED HELP ASAPPPPP!!! PLSSS
    6·1 answer
  • Answer my questions plz​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!