1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]2 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
Fish eat algae, which are organisms that make their own food. Which two types of organisms are present in this scenario? consume
vaieri [72.5K]

Answer:

Consumer and producer

Explanation:

Algae is a producer, making its own food with the sun. The fish is a consumer, consuming the algae for food.

4 0
3 years ago
How can animals have difficulty getting energy
Amanda [17]
<span>Plants absorb energy from the sun and use photosynthesis to make sugars. Animals have mitochondria that use the sugars provided by plants to produce their own cellular energy. If there is not plant animal will have difficulty in getting energy. Also there are competition on the part of animals and human. I hope it helps. </span>
6 0
3 years ago
Which of the following is not an adaptation of California thrashers to life in the chaparral biome?
Liono4ka [1.6K]
If NOCTURNAL ACTIVITY is one of the choices, that's your answer. 
6 0
3 years ago
When constructing a dichotomous key, you should start with general characteristics and then move to more specific characteristic
cluponka [151]
True. it starts off simple then you move into details
3 0
3 years ago
Read 2 more answers
It would be amazing if you can help
Tom [10]
A) planets with long orbits

*all planets in groups 1 and 2 revolve around the sun!
*planets in groups 1 and 2 have moons
*group 2 have the fastest rotations

Our solar system is divided into two sections, the first section being the inner planets consisting of Mercury, Venus, Earth, and Mars.
The second section consists of Jupiter, Saturn, Uranus, Neptune, and Pluto.

The main differences between the two sections are distance from the sun. With the exception of Pluto, All outer planets are massive in comparison to the inner planets.
7 0
3 years ago
Other questions:
  • What stage of cellular respiration use the high-energy electrons from NADH and FADH2 to form ATP molecules
    13·1 answer
  • Where are volcanoes most likely to occur
    9·1 answer
  • Name and describe the main parts of a typical virus.
    13·1 answer
  • If you expose HeLa cells to 3H-thymidine just as they enter S phase, then wash this material off the cells and let them go throu
    13·2 answers
  • List at least three characters that all living things share
    9·1 answer
  • Characteristic in your own words.
    6·1 answer
  • Question 2 of 7 Which substance do plants use to make sugars? O A. Oxygen B. Ammonia O C. Nitrates O D. Carbon dioxide​
    10·1 answer
  • What is represented by R? How many are there?
    12·1 answer
  • 7. If an isotope of oxygen (O) has 1 less neutron, how many electrons does it have?
    6·1 answer
  • PHYSIOLOGY:<br> What can happen if the endocrine system malfunctions?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!