1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]2 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
PLEASE HELP!! i need help with this for biology i’m desperate please
Vanyuwa [196]

As per the demonstration of Griffith and Avery, it can be concluded that the given experiment finding supports hypothesis III, i.e. genetic material or transforming substance is DNA.

<h3>What is Genetic material?</h3>

Genetic material may be defined as any substance found in the cells of plants, animals, microbial or other origins that hold genetic information and that departs it from one generation to the next.

In 1944, Avery and others concluded that the transforming material was pure DNA, not protein or RNA.

These investigators found that DNA extracted from a virulent strain of the bacterium Pneumococcus genetically transformed an avirulent strain of the organism into a virulent form.

Therefore, as per the demonstration of Griffith and Avery, it can be concluded that the given experiment finding supports hypothesis III, i.e. genetic material or transforming substance is DNA.

To learn more about Griffith's experiment, refer to the link:

brainly.com/question/8950307

#SPJ1

7 0
2 years ago
When two atoms share a pair of electrons, the bonding is referred to as
snow_tiger [21]
Answer =  a covalent bond
8 0
3 years ago
As an infant, the ability to produce antibodies is
fiasKO [112]
A baby's immune system is not fully developed until he/she is about six months-old. In the meantime, pregnant mothers pass immunoglobulin antibodies from their bloodstream, through the placenta, and to the fetus. These antibodies are an essential part of the fetus's immune system. They identify and bind to harmful substances, such as bacteria, viruses, and fungi that enter the body. This triggers other immune cells to destroy the foreign substance.
4 0
3 years ago
Read 2 more answers
Luteinizing hormone is bound to transport proteins in the plasma. <br> a. True<br> b. False
Tanzania [10]

Answer:

FALSE

Explanation:

Luteinizing hormone, also known as the lutropin, is a heterodimeric glycoprotein produced by the gonadotropic cells of the anterior pituitary gland.

The function of the luteinizing hormone in males is the secretion of the progesterone hormone. Whereas, in females, the acute rise of this hormone triggers ovulation, maintains the corpus luteum and is also responsible for the secretion of progesterone hormone.            

4 0
3 years ago
HELP! A 20-kg bag of rice dropped from an airplane. What is the gravitational force on the bag? Acceleration due to gravity is 9
AlekseyPX

Answer:

20.8

Explanation:

I took it and it was right

5 0
3 years ago
Other questions:
  • Only about 10 percent of the energy in an organism is passed on to the next level of a food chain. Look at this food chain: gras
    9·1 answer
  • Specifically how long did each eon last?
    9·1 answer
  • The pyruvate dehydrogenase (PDH) complex catalyzes the oxidative decarboxylation of pyruvate to acetyl−CoA and CO 2 . CO2. Multi
    7·1 answer
  • Cellulose and starch are both polysaccharides. Polysaccharides are polymers of monosaccharides sometimes referred to as complex
    5·1 answer
  • If homeostasis is not maintained, what disease/disorder may occur in the respiratory system
    5·1 answer
  • PLEASE HELP!! I NEED TO SUBMIT THIS IN 20 MINUTES
    8·2 answers
  • It is a state of well-being when all internal and external body parts, organs, tissues and cells can function properly as they a
    8·2 answers
  • Eukaryotes that are not fungi, animals, or plants are classified in a "catch-all" category called ________. A. archaea B. protis
    14·1 answer
  • Can someone plss help me with this and give good explanations!!!
    8·1 answer
  • Human skin color varies widely around the world, and children do not always exhibit the exact same coloring as their parents. Ba
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!