1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]2 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
If a pea plant has a ressive allele for green peas, it will produce
insens350 [35]
D. Yellow peas if it does not also have a dominant allele for green peas
5 0
3 years ago
​perimenopause ____.
Stels [109]

Answer:

a. is marked by limited changes in reproductive hormones

Explanation:

6 0
3 years ago
A nurse provides care for a client receiving oxygen from a nonrebreather mask. which nursing intervention has the highest priori
Maksim231197 [3]
Assessing the clients respiratory status, orientation, and skin color. 
3 0
3 years ago
How does CO2 level affect oxygen production?
Elina [12.6K]

Answer:

Grupa chemików z Uniwersytetu Środkowej Florydy pod kierownictwem profesora Fernando Uribe-Romo, odkryła sposób zamiany dwutlenku węgla w paliwo i tlen — naśladując naturalne procesy w jakich rośliny konsumują CO2, czyli fotosyntezę, która z dwutlenku węgla i wody produkuje węglowodany czyli paliwo dla organizmów żywych.

Explanation:

3 0
3 years ago
Read 2 more answers
In the couple described in Problem, the woman gives birth to a color-deficient but otherwise normal daughter. The husband sues f
Rashid [163]

Answer:

See the answer below

Explanation:

<u>From the problem, color is X-linked. Males have just one (XY) chromosome while females have two (XX). Hence, for a recessive trait, males will need only one allele to be affected while females will need two alleles.</u>

Dominant form allele for normal vision = C

Recessive form allele for color deficiency = c

Genotype of a man with normal color vision = X^CY

Genotype of a woman with color deficiency = X^cX^c

Crossing the two:

                                         X^CY    x    X^cX^c

   X^CX^c                       X^CX^c                     X^cY                    X^cY

<em>normal female     normal female      affected male      affected male</em>

(a) All their sons would be affected for color deficiency. Hence, the probability of them having a color-deficient son is 100% or 1.

(b) None of their daughters is supposed to be affected for color deficiency. Hence the probability of them having a color-deficient daughter is 0.

<em>If the woman gives birth to a color-deficient but otherwise normal daughter and husband sues for a divorce on the ground of adultery, the case will definitely stand up in the court because none of their daughters can be affected for color deficiency based on genes of the man and the woman. </em>

<em>In order to produce an affected daughter, the father will need to supply an affected X chromosome in conjunction with the one that will be supplied by the woman. </em>

<em>In this case, the man does not have an affected chromosome, hence it is not possible for them to have an affected daughter except that the woman slept with another man who happens to have an affected X chromosome.</em>

<em />

7 0
3 years ago
Other questions:
  • Do you think humans should try to set up a colony on Mars? Why or why not?
    14·1 answer
  • The purposes of zoos and aquariums are the following four reasons. Match the definition with the term.
    5·1 answer
  • What are enzymes, and why are they important to living things?
    11·1 answer
  • Drag and drop a term to match these examples with the correct level of organization.
    10·1 answer
  • Scientists have found another horse fossil called Mesohippus which had a shoulder height of 60cm and had 3 toes. Make a hypothes
    15·1 answer
  • What function do decomposers provide in a food web?They produce organic compounds in the presence of sunlight and chlorophyll.Th
    10·1 answer
  • Describe how the integumentary system responds to differences in sunlight
    15·1 answer
  • A motorist travels 406 m during a 177.0 s period. what was the average velocity?
    7·1 answer
  • Simplify the expression 53 + 3(5 − 3).<br> 137<br> 131<br> 27<br> 21<br><br> Question 4
    12·2 answers
  • The diagram below shows the stages of succession in a forest ecosystem.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!