1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
3 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]3 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
What is indicated by two species having similar amino acids in the hemoglobin protein?
Anna71 [15]
Answer: The two species were Rhesus monkey and Human <span>
Hemoglobin protein is the iron containing protein found in the red blood cells which function by transporting oxygen through the blood stream from from the lungs to the tissues and it is important for survival. However, the  two species that have similar amino acids in the hemoglobin protein were Rhesus monkey and Human because they were not far from others.</span>
3 0
4 years ago
2. What is the role of a decomposer in a food web?
LekaFEV [45]

Answer:

D

Explanation: Decomposers are like grinders, they break down dead animals and plants.

7 0
3 years ago
Read 2 more answers
What is the difference between primate and no-primate eye orbits
Alborosie
Primates refer to mammals characterized by there large brain and complex behavior. Non - primates refer to any animal that’s not a mammal
8 0
3 years ago
How do RNA's subcomponents affect its properties? (3 points) A. Adenine and cytosine bond with thymine and guanine, respectively
frozen [14]

Answer:

B. Base pairing occurs within an RNA molecule to give RNA the three-dimensional shape needed for specific functions.

Explanation:

Ribonucleic acid, known as RNA, is a type of nucleic acid found in living systems. In opposition to the other type of nucleic acid (DNA), RNA is a short single stranded molecule. Both DNA and RNA are made of nucleotides, composed of a phosphate group, nitrogenous bases and a pentose sugar.

The presence of ribose sugar and Uracil base in RNA instead of deoxyribose sugar and thymine base respectively structurally differentiates the molecule from DNA. However, base pairing occurs within the RNA molecule to form the three-dimensional shape of the RNA, which is key to the specificity of its function.

6 0
4 years ago
The units of genetic distance derived from bacterial conjugation studies are called _____.
Bad White [126]
The units of genetic distance derived from bacterial conjugation studies are called minutes. Bacterial conjugation is the process by which a bacterium transfers genetic materials to another through direct contact. One bacterium serves as a donor of the genetic material and the other serves as the recipient. 
4 0
3 years ago
Other questions:
  • At which station is precipitation most likely occurring at the present time
    7·1 answer
  • Describe the vegetation: What are 3-5 common plant types found in this area (usually types of trees)? It is important to remembe
    7·1 answer
  • Which of the following statements is true?
    13·1 answer
  • ATP and glucose are both molecules that organisms use for energy. They are like the tank of a tanker truck that delivers gas to
    11·1 answer
  • Which is the correct way to write the scientific name of a fruit fly?
    11·1 answer
  • What do the rib muscles and diaphragm have in common?
    7·2 answers
  • Why does catalase function most efficiently at the pH level of 7
    5·1 answer
  • How do i know what elements will form chemical bonds
    13·2 answers
  • What caused seed abundance to decrease from 1975 to 1978
    6·1 answer
  • Give 4 examples of types of specialized cells.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!