1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
3 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]3 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
Are data that do not support a hypothesis useful?
MakcuM [25]

Answer:

D

really dude, just read these types of questions the one that's really different is usually right

8 0
2 years ago
How did doctors harvest and culture cells from henrietta lacks?
Assoli18 [71]
Cells were taken while she was being treated for cancer many years ago and these cells have been cultured in the lab ever since.
3 0
4 years ago
Blank blood cells are also produced that are important for the body's blank system
solniwko [45]

Answer:

White

Immune

Explanation:

White blood cells, also called leukocytes, are one of the cells that are involved in the body's immune system. They protect the body against various infections diseases and other invaders. Leukocytes are produced in the bone marrow (hematopoietic stem cells). They are not the only cells that are important for the defense of the body but are important.

8 0
3 years ago
Explain how heredity can be illustrated mathematically.
shepuryov [24]
By using ratios. You get a punnet square and then get the ratio or even the percentage.
7 0
3 years ago
How does urbanization affect your life and the area in which you live
ASHA 777 [7]

Answer:

Population growth, lack of supplies

Explanation:

Urbanization can impact an area, especially population growth. People could be crowded, and that supplies could run out as it is an urbanized region.

6 0
3 years ago
Other questions:
  • 10 POINTS PLEASE HELP
    12·1 answer
  • The atmosphere is an example of an exchange pool for water
    14·1 answer
  • Which is a function of the protein hemoglobin?
    11·2 answers
  • In some bees, thin stripes (S) are dominant over thick stripes (s) and black eyes (B) are dominant over gray eyes (b). Complete
    6·2 answers
  • Are the kidneys considered highly vascularized? why or why not?
    13·1 answer
  • Membranes prevent movement of most substances between the cell and the environment, but most required substances can be moved Ch
    8·1 answer
  • The length of a vector arrow represents its ___
    13·2 answers
  • Select all the correct answers.
    7·1 answer
  • Hey! pls help i’ll give brainliest
    14·2 answers
  • A carbohydrate sample weighing 0. 235 g was found to have a fuel value of 3. 84 kj. What is the fuel value of one gram of this c
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!