1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]2 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
What are the two main phases of the cell cycle
erica [24]

Answer:

interphase and the mitotic (M) phase.

Explanation:

The stages of the cell cycle are divided into two major phases: interphase and the mitotic (M) phase.

4 0
3 years ago
Read 2 more answers
What kind of energy do these refrigerators utilize
kap26 [50]
Electricity And Gas
5 0
3 years ago
RR
alekssr [168]

Answer:

c. the offspring are genetically different from either of the parent plant.

Explanation:

The plant has it's own DNA that comes from both parents. The pink is a result of a mixture between the red and white.

7 0
3 years ago
How does the structure of water contribute to its unique properties
frutty [35]

So basically water is a polar molicule. So when it comes to the structure, water is able to form many hydrogen bonds and the way the atoms are able to bond together adds to the water's special properties.

8 0
3 years ago
During replication, which sequence of nucleotides would pair with the DNA segment TTACGC? GGACTC AATGCG UUAGCG AACGTG
Lemur [1.5K]

Answer:

The Answer would be AATGCG.

Explanation: The reason is because A pairs with T and C pairs with G.

5 0
3 years ago
Read 2 more answers
Other questions:
  • In some isogamous protists, the act of fertilization involves the transfer of genetic information. This function is called _____
    7·2 answers
  • Which sentence would be inappropriate in an informational piece of writing with a formal tone?
    15·2 answers
  • Han takes a shower in his family’s new apartment. He gets the water perfect—not too hot, because that hurts! Then Han hears his
    14·1 answer
  • Which organelle is responsible for manufacturing proteins? vacuoles lysosomes golgi apparatus ribosomes
    7·1 answer
  • The branch of biology dealing with interactions among organisms and between organisms and their environment is called
    14·2 answers
  • Nancy's diet is deficient in iodine. This will affect the secretion of which hormone?
    7·1 answer
  • Fuel that is formed from burning recently living, organic products is
    14·1 answer
  • A scienntist is examining an organism that feeds on decaying matter to gain energy for survival. What kingdon would be the best
    9·1 answer
  • If the ocean current starts near the equator, can it warm up the air of any location it passes? *
    10·1 answer
  • If some bacteria are resistant to tetracycline and some are not resistant, what happens when a patient is given tetracycline for
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!