1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
3 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]3 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
Please hurry this is timed
blondinia [14]
Mutualism. e.g. oxpecker and zebra
commensalism. e.g. remora fish and sharks
parasitism. e.g. tapeworms and cow
4 0
3 years ago
Read 2 more answers
Which scenario is an example of a scientific way of thinking?
Brums [2.3K]

Answer:

beginner at this what he proves to be true

7 0
3 years ago
What does a capital letter, such as t, represent in a punnett square?
vovikov84 [41]
A capital letter represents<span> the dominant form of a gene (allele), and a lowercase </span>letter is the abbreviation for the recessive form of the gene (allele). <span>The </span>Punnett square<span> is a diagram that is used to predict an outcome of a particular cross or breeding experiment.</span>
8 0
3 years ago
Read 2 more answers
MARKING BRAINILIEST!!!!
maria [59]

Answer:

1. Plants use the energy of the sun to change water and carbon dioxide into a sugar called glucose.

2.  Sun energy is converted into chemical energy called photosynthesis.

Explanation:

I hope it helps! Have a great day!!

7 0
3 years ago
Read 2 more answers
I am generally found both inside and outside of the nucleus [in eukaryotic cells]
alukav5142 [94]

Answer:

In eukaryotic cells, the cytoplasm includes all of the material inside the cell and outside of the nucleus. All of the organelles in eukaryotic cells, such as the nucleus, endoplasmic reticulum, and mitochondria, are located in the cytoplasm.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • The food webs that horse fly is integrated in and how it contributes to trophic levels of ecosystem?
    13·1 answer
  • What effect does the temperature of the nest have on the turtle reproduction?
    15·1 answer
  • What are the different forms of genes inherited from each parent
    13·1 answer
  • In E. coli, there is a mutation in a gene called dnaB that alters the helicase that normally acts at the origin of replication.
    14·1 answer
  • A 20 fluid oz. soda contains 201 calories. how many kilojoules does the soda contain?
    11·2 answers
  • Antibiotics exploit differences in structure between prokaryotes and eukaryotes in order to selectively attack pathogenic bacter
    10·1 answer
  • What lobe is found in the area designated by label 1?<br>A) occipital<br>B) frontal
    8·2 answers
  • Please help me answer this as fast as you can!!!!!
    12·1 answer
  • A.
    15·2 answers
  • In certain species of plants, purple flowers (P) are dominant to white flowers (p). If two heterozygous plants are crossed, what
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!