1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
3 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]3 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
An analysis of a lipid shows that it is made up of two fatty acids and a phosphate group, each bonded to a glycerol molecule. Th
wel
Lipid is a fat and can be used as an energy reserve.
Hope this helps!!
8 0
3 years ago
Read 2 more answers
According to Gregor Mendel’s laws of genetics inheritance, when two parents have different genes for a trait, one form of the tr
andre [41]
The kittens fur should be gray because if you put it in a punnet square A is dominant over a because the outcomes are Aa
7 0
3 years ago
Read 2 more answers
What is the function of RNA polymerase in protein synthesis?
Lesechka [4]
It creates an mRNA copy of template DNA. The mRNA is then pushed into the cytoplasm  of the cell where it is ready by ribosomes.

Hope this helps!!
6 0
4 years ago
Read 2 more answers
The cell cycle is a spontaneous occurrence where the cell shrinks to less than half its size
otez555 [7]
Your answer is False

Hope this helped!!!
3 0
3 years ago
Read 2 more answers
1-As we move from left to right across the periodic table, what is the general trend?
IRINA_888 [86]
I want to say that it would be the 'atomic radius' that would increase. Because as this would happen, the atoms would then get smaller and smaller, mainly because the radius would just get smaller and also the atoms would also.

8 0
4 years ago
Read 2 more answers
Other questions:
  • Example of organisms
    11·1 answer
  • What property of water gives it a strong surface tension
    6·2 answers
  • Which moon phases would produce higher high tides !
    15·2 answers
  • An organism with 24 chromosomes in each body cell will produce sex cells with __________ chromosomes. A) 12 B) 24 C) 48 D) 96
    7·1 answer
  • What four pieces of information is included in a providers credentials
    8·1 answer
  • Help!!! look at the picture!
    5·1 answer
  • How do enzymes affect the reactions in living cells?
    15·1 answer
  • How much will atmospheric carbon change in one year?
    14·1 answer
  • Describe the physiology of bones
    10·1 answer
  • What allows lysosomes to
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!