1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]2 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
1. Refer to objective #11 ("Discuss how technology has improved our ability to find and use ocean resources.". If you visit the
Kruka [31]

Answer:

k

Explanation:

4 0
2 years ago
Pls help with this question guys
professor190 [17]

Answer:

I'm pretty sure its C

Explanation:

the other options aren't as good as the other options.

4 0
2 years ago
The endoplasmic reticulum is an intricate _____ system.
Papessa [141]
<span>A. transformation is the answer </span>
3 0
2 years ago
Por que o nosso nariz fica entupido quando estamos resfriados?
Lubov Fominskaja [6]

why does our nose get stuffy when we have a cold

Answer:

Due to dilation of blood vessels in the sinuses of the nose

Explanation:

Often times, we think our nose gets stuffed up due to the excess mucus in times of cold but it is not always so.

We get stuffed due to the body's homeostasis, a drive to internally control and balance the outside environment.

  • During cold, blood vessels dilate so as to allow for more inflow of blood.
  • Incoming blood brings in more heat to the body parts.
6 0
3 years ago
A, B, C, or D? Please help!
Alexeev081 [22]

I'm not sure of this question, yet i know you may get angry but, just know your loved and if going through a hard time i'm so so sorry, i know how it feels it sucks. take care of yourself, drink water, listen to that one song that makes you dance in your room and go do what YOU love. your beautiful your perfect and dont listen to what anyone says. i love u, everyone loves u, i know its scary but it happens to everyone life isnt a peice of cake unfortunatly and it sucks but woahh your strong! if you need someone to talk to leave a comment below, happy hoildays everyone!

P.S, im looking into the answer of this question. I may not answer it right on time (since i'm not the smartest...) but i promise ill try my best! Also, i am not doing this for points im doing this to make others smile. I hate how no one checks up on anyone, lots of people are going through a stressful time (including me) and i just want to let everyone know that its okay not to be okay! I hope that you all find happiness in every possible situation, once again  HAPPY HOLIDAYS! Also, good luck. Please dont stress it!

5 0
2 years ago
Read 2 more answers
Other questions:
  • What is the significance of an eyespot in the cell of Euglena?
    8·1 answer
  • In contrast to eukaryotic cells, prokaryotic cells 
    11·1 answer
  • Organisms that are not autotrophs
    8·1 answer
  • A change in the base sequence of dna that is passed on to daughter cells is __________.
    12·1 answer
  • The components of the human body. from organ systems to cell organelles, interact to maintain a balanced intemal environment. To
    14·1 answer
  • what is the smallest unit that can carry on all functions of life? A) cells B) elements C) molecules D) organelles
    6·2 answers
  • Which of the following is an example of a light reflector?
    5·1 answer
  • How might translation and transcription be considered creative?
    10·1 answer
  • How does Matter move throughout the ecosystem
    12·1 answer
  • What is the origin of the sunflower?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!