1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
12

Help I'm confused!

Biology
1 answer:
aev [14]2 years ago
7 0

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

You might be interested in
Step to cleaning a polluted beach
jonny [76]
1. Plan a date
2. Approve with parents
3. Get friends or a club to help
4. Try to get an adult or two ( Be smart. Be safe)
5. Grab lots of trash bags and maybe gloves.
6. Pack food and water at you will be out for a while
7. HAVE FUNN!!

-Jay❤️
6 0
3 years ago
one important difference between living things (biotic) and nonliving things (abiotic) is that only living things have
Mamont248 [21]
The answer is: D. Cells
7 0
3 years ago
Read 2 more answers
after seeing lightning flash you hear the clap of Thunder 5 seconds later how far away is the lightning (speed of sound=340 m/s)
Alecsey [184]

So sound travels 1 kilometer in roughly 3 seconds and 1 mile in roughly 5 seconds. When you see the flash of a lightning bolt, you can start counting seconds and then divide to see how far away the lightning struck.

3 0
3 years ago
What would happen if the G at the end of the AUG codon were deleted?
Alla [95]

Answer:

Not 100% sure- Hope it helps though

Explanation:

Since codons consist of three base pairs, if, for example, only one or two base pairs are deleted, then the way the DNA is read is shifted at the place of the deletion or insertion. After the place of the mutation, ALL of the amino acids that follow will be different.

6 0
2 years ago
1. How does base pairing differ in RNA, compared to DNA?
Setler79 [48]

Answer:

A. A pairs with U

Explanation:

In DNA, the nitrogenous bases are A, T, G, and C. In RNA, the nitrogenous bases are A, U, G, and C.

A pairs with U in RNA because it requires less energy to use uracil over thymine.

Hope that helps.

8 0
3 years ago
Other questions:
  • Which of the following statements about the environmental movement is true?
    15·2 answers
  • URGENT!!<br> please help me solve this i really don’t understand it
    14·1 answer
  • Please help me. I need more than just one example on this graded assignment. I'm stuck AF..
    6·1 answer
  • What is a bathyscaphe?
    6·2 answers
  • Puritan disagreement over the use of inoculations for smallpox reflected tensions over what broader issue?
    11·1 answer
  • In the lab, Nachman examined dark mice from two different populations living hundreds of miles apart. The mice looked nearly ide
    6·1 answer
  • Why is Darwin's ideas considered to be so great?
    14·1 answer
  • Tetrahydrofolate is important for the activity of which enzyme?
    12·1 answer
  • Where are the sensors for the arterial baroreceptor reflex located?a. cardiovascular centers in the medulla oblongatab. The symp
    14·1 answer
  • A connective tissue disorder in which dense irregular connective tissue fails to form properly will affect the formation of
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!