All categories

3 years ago

8. Define the following terms:

Biology

1 answer:

noname [10]3 years ago

4 0

Answer:

Adam Smith: The Father of Economics

laissez-faire," or free-market,

invisible hand:The concept of the "invisible hand" was explained by Adam Smith in his 1776 classic foundational work, "An Inquiry into the Nature and Causes of the Wealth of Nations." It referred to the indirect or unintended benefits for society that result from the operations of a free market economy

consumer sovereignty:the situation in an economy where the desires and needs of consumers control the output of producers.

incentive:a thing that motivates or encourages one to do something

profit:a financial gain, especially the difference between the amount earned and the amount spent in buying, operating, or producing something.

specialization:the process of concentrating on and becoming expert in a particular subject or skill.

You might be interested in

Which phrase is the best summary of the model?

emmainna [20.7K]

D, a net transfer of energy

7 0

3 years ago

Read 2 more answers

Eliza wants to increase the yield of her herb garden. A friend suggests that Eliza pinch off the tops of the plants as they grow

kondor19780726 [428]

<span>At the top of plant shoots or roots of plants is an organism called meristem. This organism produces auxin, which causes the shoot or root to grow. This shows that by pinching off the tops of the plants, it makes them grow more.</span>

3 0

3 years ago

Read 2 more answers

5. Why do populations have variation in certain traits?

Molodets [167]

Answer:

Variations are caused by mutation. random mating between organisms.

Explanation:

4 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Which of the following is NOT a beta-lactam antibiotic?

emmainna [20.7K]

Answer:

vancomycin

Explanation:

β-lactam antibiotics are those antibiotic that that contain a beta-lactam ring (the cyclic amide with the nitrogen atom attached to the β-carbon) in their molecular structures. This class of antibiotics is the most commonly used and it includes penicillin derivatives, cephalosporins, monobactams, and carbapenems. The mechanism of action of β-lactam antibiotics is inhibition of cell wall biosynthesis in the bacteria.

4 0

3 years ago