1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
14

What Will happen if a thermostat gets to cool

Biology
1 answer:
quester [9]3 years ago
8 0

Answer:

Explanation:it will freeze up

You might be interested in
Minerals form from magma in predictable patterns in a process know as
klemol [59]

Minerals form from magma in predictable patterns in a process known as Bowen's reaction series.

Bowen's reaction series is the general model for the formation and the crystallization sequence of magma as the cooling process occurs. Bowen's reaction series was the idea of Norman L. Bowen. The series explains that minerals crystallize differently at certain temperatures as they cool. It also states why specific types of minerals are found together and why others are almost never connected with one another.


5 0
3 years ago
Read 2 more answers
how was the prairie lupine important to the growth of plants on the barren land found after the eruption?
Nimfa-mama [501]

Answer:

they fixed nitrogen in plants affected from the eruption by enriching the soil.

Explanation:

6 0
2 years ago
How do consumers get the chemical energy they need to live and grow?
Mandarinka [93]
<span>Consumers obtain their energy from devouring other organisms. </span>
6 0
3 years ago
Name a species (common name is fine) of Saurischia (dinosaurs) that isn't extinct
Veronika [31]

One example of a common day Saurischia, or more accurately a currently living direct descendent of this group, is the chicken.

As far as the Saurischia go, they represent a large group of dinosaur species. The fact is that long ago, <em><u>all non-avian members of this group went </u></em><em><u>extinct</u></em><em><u>.</u></em> The remaining members were avians, a word currently associated with birds. This in part provides an explanation for the fact that most of these remaining Saurischia later evolved into many of the common-day birds we see in the modern world.

Therefore, to give the most popular and clear example of what we can consider as a <u>member of the </u><u>Saurischia</u><u> that is still alive today</u>, we can use the common chicken. The chicken is a direct descendent of the dinosaurs and is <u>the animal that genetically is the closest in relation to </u><u>dinosaurs</u><u>. </u>

To learn more visit:

brainly.com/question/24638466?referrer=searchResults

8 0
2 years ago
Which of the following would most likely be the major focus of a biologist?
vlabodo [156]

Answer:

bacteria found in hot springs

Explanation:

it might be valuable one strain of bacteria

6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the correct description of the relationship between osmosis and diffusion?
    8·2 answers
  • Heyy this is really urgent,please help. I will mark brainliest
    15·1 answer
  • TRUE OR FALSE PLEASE HELP ME WITH THIS
    14·2 answers
  • Blue eyes are dominant to red eyes in rabbits show a heterozygous blue eyed rabbit crossed with a red eyed rabbit
    10·1 answer
  • Rosa is taking calculus and is very anxious that she will not do well. On her first test, Rosa scores a 60%. For her second test
    5·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What is a Bivalents in biology ​
    9·2 answers
  • Explain one way that that the sun can change the state of matter (liquid, gas, and solids).
    5·1 answer
  • Horses and zebras can be bred to produce a zorse, which is infertile. Which is most likely the reason zebras and horses are cons
    13·1 answer
  • I need help on a RACE response
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!