1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jok3333 [9.3K]
3 years ago
6

The answer is 1 3 and 4 i got it right

Biology
2 answers:
attashe74 [19]3 years ago
7 0

Answer:

did you forget a file or picture?

Explanation:

Elenna [48]3 years ago
4 0

Answer:

where is the file attachment?

You might be interested in
Explain how animals may have influenced the evolution of terrestrial plants and vice versa​
Genrish500 [490]
<h2>Answer:</h2>

<h3><em>Microsporangium</em><em> </em><em>give</em><em> </em><em>microspores</em><em> </em><em>by </em><em>meiosis</em><em>.</em></h3>

<h3><em>Microsporangium</em><em> give</em><em> microspores</em><em> by</em><em> meiosis</em><em> </em><em>each</em><em> </em><em>microspores</em><em> </em><em>forms</em><em> </em><em>a </em><em>pollen </em><em>grain</em><em> </em><em>Pollen </em><em>wall </em><em>is </em><em>secreted</em><em> by</em><em> </em><em>surrounding</em><em> </em><em>sporophytes</em><em> </em><em>tissue</em><em> </em><em>Enclosed</em><em> </em><em>male </em><em>gametophyte</em><em> </em><em>produces</em><em> </em><em>sperm</em><em> </em><em>by </em><em>mitosis</em><em>.</em><em> </em></h3>

<h2><em>Mark</em><em> me</em><em> as</em><em> brainliest</em><em> ❤️</em></h2>

3 0
3 years ago
hey could someone help me with this immediately!! i’ll mark brainiest if u don’t guess or leave a link!
Tems11 [23]

Answer:

Adding heat causes a chemical change in the particles of the egg that makes it solid.

Explanation:

Brainliest please!

6 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
What company owns much of the bottled water industry
Korvikt [17]
Nestle would be the answer
5 0
3 years ago
Read 2 more answers
Evolution of shorter legs in anole lizards placed on small, hurricane-scrubbed islands is an example of which type of evolution?
Paraphin [41]

This type of evolution is known as Microevolution.

Microevolution is the gradual shift in allele frequencies within a population.  Four separate processes—mutation, natural and artificial selection, gene flow, and genetic drift—are responsible for this shift. Compared to the changes referred to as macroevolution, this transformation occurs over a very brief period of time (in evolutionary terms).

The area of biology known as population genetics offers a mathematical framework for the study of the microevolutionary process. The goal of ecological genetics is to track microevolution in the natural world. Microevolution is frequently seen in visible forms of evolution, such as antibiotic-resistant bacterial strains.

Speciation, which supplies the building blocks for macroevolution, may result from microevolution.

Therefore, the correct answer is Microevolution. The Microevolution in which Anole lizards on tiny, hurricane-ravaged islands evolved shorter legs.

Know more about Anole Lizard:

brainly.com/question/11469646

#SPJ4

5 0
2 years ago
Other questions:
  • Which of the following best explains the public's shift to support local farming?
    15·1 answer
  • Based on the illustration, what happens to most of the mass gained by the plant cell through photosynthesis?
    13·1 answer
  • two cells in the same organism differ only in the number of chloroplasts they contain. the first cell had multiple chloroplasts,
    15·1 answer
  • What are some of the scientific achievements of the hellenistic period
    11·1 answer
  • A gymnosperm is in the sporophyte phase of its life cycle. Which of the following most likely happens next in the gymnosperm's l
    15·2 answers
  • What is the Definition of life?
    15·2 answers
  • Select all that apply. the m phase consists of different phases or stages. they are _____. interphase g0 phase prophase anaphase
    13·2 answers
  • "What non-native species reached plague proportions but were finally brought under control after the purposeful introduction of
    11·1 answer
  • In the moth species, some moths have larger spots than others. This is an example of
    12·1 answer
  • From earliest to latest, the overall sequence of early development proceeds as follows: A) gastrulation → organogenesis → cleava
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!