1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmainna [20.7K]
3 years ago
9

Compression is the type of stress that deforms rock at which location?

Biology
2 answers:
Butoxors [25]3 years ago
5 0

Answer:

I think the answer would be A.

ankoles [38]3 years ago
3 0

Convergent boundaries

Explanation:

You might be interested in
Which of the following properties describes a soil’s ability to supply nutrients?
ivanzaharov [21]
The correct answer is soul fertility. Soil fertility refers to the ability of soil to sustain agricultural plant growth, i.e. to provide plant habitat and result in sustained and consistent yields of high quality.[1] A fertile soil has the following properties:[2]

The ability to supply essential plant nutrients and water in adequate amounts and proportions for plant growth and reproduction; and
The absence of toxic substances which may inhibit plant growth.
6 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Mass is measured in ____________, and weight is measured in ______________.
Nataly_w [17]
<span>D) kilograms, newtons
Hope this helps!(: </span>
7 0
3 years ago
Read 2 more answers
Approximately how many different genes can be found in a human cell?
Anastasy [175]
Im pretty sure its 20,000-25,000
7 0
3 years ago
Read 2 more answers
Antibiotics have been used to treat bacterial infections since the 1940s. In
mamaluj [8]
The first answer because it’s natural selection when the weak die off the the strong get stronger also the strong produces more which stops antibiotics form working which is why we have antibiotics consistently changing
4 0
3 years ago
Other questions:
  • Describe an environmental factor that could
    11·1 answer
  • How many crabs are in hawaii
    7·1 answer
  • Explain how water’s polarity is related to its boiling point
    15·1 answer
  • Is a tank full of gasoline potential or kinetic?
    10·1 answer
  • Organic compounds are made up of all except which of the following elements
    13·1 answer
  • A flood hit an area, destroying much of the surrounding ecosystem. One animal species survived the flood, but all of its competi
    7·1 answer
  • Scientific modelling is a scientific activity, the aim of which is to make a particular part or feature of the world easier to u
    12·2 answers
  • How are rogue waves and tsunamis alike and different?
    9·1 answer
  • What organ does NOT belong in the nervous system? Provide a small explanation from the internet.
    14·2 answers
  • Why are both carbohydrates and lipids important in animal cells?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!