Answer: Aldolase
Explanation:
In the metabolism of glucose( glycolysis) phosphofructokinase is an enzyme that catalyzes the conversation of fructose-6-phosphate into fructose-1,6-bisphosphate. This in turn is converted to pyruvate after various steps of enzymatic activity in the glycolytic pathway.
If phosphofructokinase experienced a mutation that interfered with substrate binding, the enzyme that is going to be most immediately impacted in terms of accessing substrate is the ALDOLASE.
Aldolase enzymes cleave fructose-1,6-bisphosphate to triose phosphates( glyceraldehyde 3-phosphate and dihydroxy-acetone phosphate) facilitating an increase in anaerobic production of ATP in muscle.
Therefore, the substrate for binding of aldolase, which is fructose-1,6-bisphosphate is lacking due to mutation of phosphofructokinase enzyme.
Answer:
Lysosomes are abundantly found in neuronal cells
Explanation:
Lysosomes are commonly found in the cells of nervous system and specifically abundant in neurons where it can observed at various stages of development. Lysosomes chief function is to degrade cellular wastes.The lysosomes extends from golgi saccules a vesicular body.Its main function is to bind with a membrane of vacuoles containing waste into which lysosomes releases it hydrolytic enzymes degraded waste inside the vacuoles itself and becomes secondary lysosomes.
Answer:
2 or 3
Explanation:
I believe it's 3, I could be wrong though.
For the generalized scheme of Alternation of generations (see p. 120), plants have two forms based on a genetic complement that are the Sporophytes (2N diploid) and Gametophyte (N haploid). The processes connecting the two stages are gametangia producing haploid spores and zygote cell growth producing haploid gametophyte. Group of answer choices
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
