1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maria [59]
3 years ago
6

25 POINTS BC NO ONE IS ANSWERING AJHBDJA

Biology
2 answers:
frozen [14]3 years ago
6 0

Answer:

Yes it can. It can cause an overdose and can cause a seziure/stroke and you can die. Half the bottle and pretty much any mg per tablet honestly. Hope this helps :)

Explanation:

liq [111]3 years ago
6 0

Answer:

The U.S. Food and Drug Administration warns that taking higher than recommended doses of Benadryl can lead to serious heart problems, seizures, coma, or even death. Oral Benadryl products shouldn’t be taken more than 6 times each day. For adults and children over 12 years of age, the maximum is 300 mg each day. For children ages 6 to 12 years, the maximum is 150 mg each day. For adults or children, Benadryl products such as the cream, gel, and spray shouldn’t be applied to the skin more than 4 times per day.

You might be interested in
How does the asian mosquite affect the ecosystem
miv72 [106K]
The asian tiger mosquito <span>has bitten lots of people causing them to die painfully.
So scientists </span><span>are trying to invent a nice way to kill all of them with out killing people.  :)</span>
8 0
4 years ago
Antibiotics have been used to treat bacterial infections since the 1940s. In
mamaluj [8]
The first answer because it’s natural selection when the weak die off the the strong get stronger also the strong produces more which stops antibiotics form working which is why we have antibiotics consistently changing
4 0
4 years ago
Join.. Girl.... s. <br>jiv-qrva-nwg ​
luda_lava [24]

Answer:

the answer is d

Explanation:

thx for the points

8 0
3 years ago
A person wants to go into business producing aluminum foil and cans. Which resource will he most likely need to acquire in large
Lunna [17]
Bauxite.
Because bauxite it mainly aluminium oxide however with some impurities
therefore its taken to a bauxite plant where the impurities are removed and the result is white aluminium oxide ( alumina).
 Aluminium is then extracted from alumina by electrolysis  
7 0
3 years ago
ASAP HELP ANSWER THIS QUESTION ILL GIVE COINS!
fenix001 [56]

Answer:

a possum playing dead

Explanation:

only one that behavioral

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which process most likely enabled the formation of the early protists? A. photosynthesis B. endosymbiosis C. conjugation D. bina
    7·2 answers
  • What would happen if fungi didn't exist
    7·2 answers
  • A magnetic pole is the part of a magnet where the magnetic effect is weakest
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Why do scientists need to perform experiments to learn about the earliest stages of the universe?
    12·1 answer
  • which type of bond forms between an anion and a cation? A. nonpolar covalent B. ionic. C. polar covalent. D. hydrogen
    5·2 answers
  • Describe at least one societal issue that scientists will be able to address using the sequence of the human genome.
    5·1 answer
  • The cohesion of water is caused by:
    5·1 answer
  • Which of the following is a true statement regarding microclimates?
    10·2 answers
  • You have colonies growing on a culture and are going to identify them. First, you do a Gram stain and viewing it on 1000x magnif
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!