1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SIZIF [17.4K]
3 years ago
10

What is a ruler like symbol used to measure distance on a map?

Geography
1 answer:
nydimaria [60]3 years ago
4 0
A ruler-like symbol used to measure distance on a map is a scale. It shows the ratio of the distance on the map to the actual distance. Hope this helps! :)
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
What is the capital of Antigua and Barbuda?​
rjkz [21]

St. John's is the capital of Antigua and Barbuda

5 0
3 years ago
Read 2 more answers
On the continent of __________, there are over 1,000 spoken languages.
GalinKa [24]

Answer:

All of them actually but the answer you want is probably south america since its around 1000

Explanation:

5 0
3 years ago
Organisms can be made up of many _____________, which could be arranged into ________________, which can make up _______________
velikii [3]

Answer:

the tendency toward a relatively stable equilibrium between interdependent elements, especially as maintained by physiological processes.

Explanation:

example Ratios of water and minerals.

Body temperature

4 0
3 years ago
8 + 12 = a. diez c. veinte b. dieciocho d. treinta
miskamm [114]
Veinte, that is 20 in spanish
3 0
3 years ago
Read 2 more answers
Other questions:
  • What's the first step of the scientific method
    5·2 answers
  • Hippocrates made important contributions in the area of:
    13·2 answers
  • The Hawaiian Islands are associated with what type of volcanism? intraplate volcanism volcanism at a divergent plate boundary su
    12·2 answers
  • Why is French still used as the language for commerce in Morocco and Algeria?
    5·1 answer
  • So I have MUN coming up and I need help on my research about Islamophobia in DR Congo Please answer fast​
    14·1 answer
  • The two sleds shown below are about to collide. When they collide, they bounce off each other and no energy is lost. The kinetic
    9·1 answer
  • 8. What is the sum of (5 - 7i) and (-3 + 4i)?​
    11·1 answer
  • In what sea is 38 degrees south and 162 degrees east
    8·1 answer
  • The CITES treaty has been helpful in protecting endangered animals and plants by:_____.
    10·1 answer
  • He im bo red asl wana talk
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!