1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shusha [124]
3 years ago
11

Match the following DNA strand to its complementary strand of RNA

Biology
2 answers:
ZanzabumX [31]3 years ago
6 0

Answer:

AAU GUU UGG UAU

it's U for T because RNA doesn't have thymine, but they contain uracil

Viktor [21]3 years ago
5 0
It’s AAU-GUU-UGG-UAU :)
You might be interested in
Which enzyme probably came from the bacterial living in the alkaline hot spring?
9966 [12]

Answer: water

Explanation:

6 0
3 years ago
10! PLEASE HELPPP LAST ONEEEEEE A LOT OF POINTSSSS!!!!
oksian1 [2.3K]

Answer:

noshe

Explanation:

4 0
3 years ago
Read 2 more answers
An infectious disease researcher isolates the pathogen responsible for an emerging disease. The microbe is grown in the lab. A p
malfutka [58]

An infectious disease researcher isolates the pathogen responsible for an emerging disease. The microbe is grown in the lab. Preparation of the laboratory-grown microbe is treated with a lethal dose of ionizing radiation and then tested for its potential as a vaccine and this is  Inactivated type of Vaccine.

<h3>What exactly are pathogens?</h3>

Pathogens include viruses, bacteria, fungi, and parasites that can enter the body and harm the immune system. Among many additional viruses that can lead to serious illnesses are anthrax, HIV, the Epstein-Barr virus, and the Zika virus.

<h3>What is vaccination?</h3>

An easy, secure, and reliable method of preventing hazardous infections before you are exposed to them is vaccination. It boosts your immune system and builds up your body's natural defenses against particular infections.

<h3>Inactivated vaccine:</h3>

In inactivated immunizations, the disease-causing microorganism is eliminated.

Inactivated vaccines typically don't provide as strong of immunity (protection) as live vaccines. Therefore, it can take several doses (booster injections) throughout time to keep up your resistance to diseases.

Using inactivated vaccinations, you can guard against

  • Flu
  • Hepatitis A
  • Polio
  • Rabies

Learn more about Vaccines here:-

brainly.com/question/27189850

#SPJ4

3 0
2 years ago
The head of a giraffe is 2.0 m above its heart and the density of the blood is 1.05 103 kg/m3. what is the difference in pressur
erastovalidia [21]
The giraffe head is higher than its heart so the blood pressure in the head must be lower than in the heart. The pressure is directly related to the density, gravity, and the height. The calculation would be:

<span>P = ρ*g*h 
</span>P= 1.05* 10^3 kg/m3 * 9.8m/s2 * 2m= <span>20 580 pascals= 20.58 kpa</span>
8 0
3 years ago
Is the reduced form of cytochrome c more likely to give up its electron to oxidized cytochrome a or cytochrome b, why? Provide a
Vadim26 [7]

Answer:

The reduced form of cytochrome c more likely to give up its electron to oxidized cytochrome a having a higher reduction potential.  

Explanation:

Electrons from NADH and FADH2 flow spontaneously from one electron carrier of the electron transport chain to the other. This occurs since the proteins of the ETC are present in the order of increasing reduction potential. The reduced cytochrome b has lower reduction potential than cytochrome c1 which in turn has a lower reduction potential than the cytochrome c.

Cytochrome c is a soluble protein and its single heme accepts an electron from cytochrome b of the Complex III. Now, cytochrome c moves to complex IV which has higher reduction potential and donates the electron to cytochrome a which in turn passes the electrons to O2 via cytochrome a3.

3 0
4 years ago
Other questions:
  • About 70% of our planet is covered by oceans. Compared to the depth of the solid portion of earth, the water on Earth forms what
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which amino acid chain will be formed by the codons AAU AAG GAC
    14·2 answers
  • Select the correct answer.
    11·1 answer
  • What is the poly name of carbohydrates
    10·1 answer
  • Which statement best summarizes the current state of land ice in
    9·1 answer
  • A train travels 67 km, north along a straight track in 39 minutes. What is the train's average velocity in kilometers per minute
    15·1 answer
  • Do specific plant species occupy all layers or are they restricted to specific layers?
    6·1 answer
  • There are 2 types of crust - Continental and Oceanic.<br> True<br> False
    7·2 answers
  • A population of 137 prairie dogs have taken up home in a school football field! The area of a football field is 7140 m2 (1.8 acr
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!