Answer:
A surface wave is a wave that moves along the interface of two different materials, like air and water.
Explanation:
<h2>a) is the correct option </h2>
Explanation:
The extracellular domain of the transmembrane receptor protein acts as binding site for primary messenger molecule whereas the transmembrane domain holds the receptor within membrane and the cytosolic domain has intrinsic tyrosine kinase activity, all these helps in proper cell signaling
If because of any mutation there is change in shape of the extracellular domain then that molecule that normally binds to the receptor protein will no longer attach hence cellular response will be deactivated
Answer:
amino acids are organic compunds.....
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
