1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ella [17]
3 years ago
5

.

Biology
1 answer:
elena-14-01-66 [18.8K]3 years ago
4 0

Answer:

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles. Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.

You might be interested in
Which statement describes surface wave
Novosadov [1.4K]

Answer:

A surface wave is a wave that moves along the interface of two different materials, like air and water.

Explanation:

4 0
3 years ago
A DNA mutation changes the shape of the extracellular domain of transmembrane receptor protein A produced by the cell. Which of
Tatiana [17]
<h2>a) is the correct option </h2>

Explanation:

The extracellular domain of the transmembrane receptor protein acts as binding site for primary messenger molecule whereas the transmembrane domain holds the receptor within membrane and the cytosolic domain has intrinsic tyrosine kinase activity, all these helps in proper cell signaling

If because of any mutation there is change in shape of the extracellular domain then that molecule that normally binds to the receptor protein will no longer attach hence cellular response will be deactivated

8 0
3 years ago
MRNA Molecule<br> AUGAACCAUUCAGUAUGG<br><br> what is the Amino Acid
Vinil7 [7]

Answer:

amino acids are organic compunds.....

6 0
3 years ago
Read 2 more answers
Cell biologist, Dr. Martine Dinen, is observing an organism's cell using a transmitting electron microscope. She notices that wi
notsponge [240]

Answer:

eukaryotic auto i think

7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • C.perfringens, an obligate anaerobe, is capable of utilizing the carbohydrates release from injured tissue as an energy source.
    8·2 answers
  • The nobility and suffering of the figures of the crucifixion (fig. 8-22) were meant to _____________.
    5·1 answer
  • A nurse is admitting a client who has a leg ulcer and a history of diabetes mellitus
    13·1 answer
  • What is the process of succession?
    10·1 answer
  • Which of these would require signal transduction?
    11·1 answer
  • Chromosomes that code for the same traits (but often different versions of those traits) are called type your answer...
    12·1 answer
  • Scientists have discovered a new species of vertebrate. It lays amniotic eggs, has a three-chambered heart, and is ectothermic.
    9·1 answer
  • A farmer found that caterpillars were eating his corn. He sprayed his field with pesticide to kill them. For the first three yea
    13·1 answer
  • PLZ HELP
    8·1 answer
  • Which of the following are techniques besides molecular clocks used by scientist to calculate the rate at which a stretch of DNA
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!