1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garik1379 [7]
3 years ago
11

__________ To their environment (indiviual organisms react in order to survive; species adapt to a specific enviroment)

Biology
1 answer:
Agata [3.3K]3 years ago
8 0

Answer:

I think it will adaptation

You might be interested in
Fermentation recycles NAD+.<br><br><br> True <br><br> False
Pachacha [2.7K]

The answer is TRUE

Here is what google says: In the process of fermentation the NADH + H+ from glycolysis will be recycled back to NAD+ so that glycolysis can continue.


5 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Describe role of plant dieseas in forest ecosystem?
Marysya12 [62]

Answer:

Explanation:

It's a normal part of nature, and one of many ecological factors that help keep the hundreds of thousands of living plants. It also keeps animals in balance with one another.

8 0
3 years ago
Why do plant cells need cell walls? What is it made up of?​
anyanavicka [17]

Answer:

The cell wall surrounds the plasma membrane of plant cells and provides tensile strength and protection against mechanical and osmotic stress. ... Plant cell walls are primarily made of cellulose, which is the most abundant macromolecule on Earth. Cellulose fibers are long, linear polymers of hundreds of glucose molecules.

Explanation: brainliest

3 0
2 years ago
Read 2 more answers
What characteristic sets streams and rivers apart?
Bumek [7]

Answer:

c Size is the answer hope it helps

5 0
3 years ago
Read 2 more answers
Other questions:
  • During which step of meiosis homologous chromosomes pair up?
    10·1 answer
  • In the 1800s, how did Darwin explain the origin of species?
    13·2 answers
  • Which of the following is NOT a characteristic that all living things share? A) a cellular organization B) using energy C) movem
    10·2 answers
  • Which landform is created by wind
    15·1 answer
  • What will cause water to enter a cell
    12·1 answer
  • What Is Another Name For Lane D In The Diagram? <br><br> C.) A Positive Control (Apex) (^∇^)
    9·1 answer
  • What are the products of aerobic cellular respiration? Check all that apply.
    13·1 answer
  • I don’t know the answer
    7·1 answer
  • PLEASE HELP I WILL MARK BRAINALISTTTT
    15·1 answer
  • Why is the low-tide is the most populated level of the intertidal zone
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!