Answer: The result of the efforts by the United States and Canadian governments to improve water quality was the GLWQA.
Explanation:
The GLWQA, is also known as the Great Lakes Water Quality Agreement. This agreement was put into place to implement actions and binational priorities that will improve the water quality of the Great Lakes. They help to restore the Great Lakes and protect the waters shared by the United States and Canada.
Answer:
Dry and barren land becomes desert.
Explanation:
Desertification is a process when the desert expands at the expense of an area that was not a desert. Basically, an area that was a steppe, for example, because of mismanagement or climate changes, can gradually become a desert as it gets drier and the land barren, so the desert will replace it.
In Africa, desertification is a big problem. Both, human mismanagement of soil and climate change have resulted in damaging the biomes that are close to the deserts, mainly the steppes. The soil is often left without nutrients so it can not support vegetation, which in turn also affects the water sources and precipitation paterns in a negative manner. The land becomes barren and drier than it was, and being close to the desert, the winds quickly manage to cover the surface with sand, converting it into a desert.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
