1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
13

Why is the inner lining of the bronchiole folded?

Biology
1 answer:
Fed [463]3 years ago
5 0
The bronchioles<span> or bronchioli are the passageways by which air passes through the nose or ... The</span>inner lining<span> (lamina propria) of these </span>bronchioles<span> is thin with no glands present, and is surrounded by a layer of smooth muscle.</span>
You might be interested in
What is the basic unit of structure and function in protists and monerans?
Alex787 [66]
I believe that the basic unit of structure and function in protists and monerans is the cell. This is because cells are basic unit of structure and function of all living things. A  cell is the smallest unit of life, it is the basic membrane-bound unit that contains the fundamental molecules of life and of which all living things are composed.
8 0
3 years ago
Classification of mycelium​
hichkok12 [17]

Answer:  Fungus

Explanation:

4 0
1 year ago
Can we please help
mojhsa [17]
A !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
8 0
3 years ago
Read 2 more answers
The bacterium Bacillus anthracis, which causes anthrax, has been developed as a biological warfare agent.
stiv31 [10]
The correct answer to this question is letter B.its ability to form endospores in harsh conditions

The bacterium Bacillus anthracis, which causes anthrax, has been developed as a biological warfare agent. The ability that could have led to this is that its ability to form endospores in harsh conditions

Anthrax usually form endospores in non-bacteria friendly environments, meaning they could get into places that would otherwise be hygienic and infect individuals.

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • Read each sentence and decide whether it describes type 1 diabetes, type 2 diabetes, or both. drag the terms on the left to the
    14·1 answer
  • Is my cat broken? wont chase laser. I'm a idiot
    7·2 answers
  • Why did identifying rock layers because of their fossils become important?
    11·2 answers
  • Describe the changes that occur in kidney and bladder function in old age
    6·1 answer
  • Si se rompe un utensilio de cristal en un laboratorio, cómo se recoge?
    15·1 answer
  • PLS!!!!!!!!HELP!!!!!!!
    10·1 answer
  • The diagram above shows a cell placed in a beaker with salt water. The cell is permeable only to water. What will happen to the
    8·1 answer
  • What is the dependent variable in the video set
    12·1 answer
  • Which property of water BEST explains how salt is able to dissolve easily in water?
    5·1 answer
  • Help, please.<br><br> States of Matter 1.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!