1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
2 years ago
6

Which of the following are considered decomposers? (select all that apply)

Biology
1 answer:
AlexFokin [52]2 years ago
3 0

Answer:

an organism, especially a soil bacterium, fungus, or invertebrate, that decomposes organic material.

Explanation:

You might be interested in
Fungi have their own kingdom in taxonomic classification. True<br> or False?<br> TRUE<br> FALSE
maksim [4K]

Answer: The Kingdom Fungi has organisms with eukaryotic cells. * They are termed as eukaryotes as they possess membrane-bound organelles and also a true nucleus( unlike prokaryotes). ... The statement - Species is the lowermost category in the hierarchy of classification of groups of organisms is true.

Explanation:

8 0
2 years ago
Read 2 more answers
This is hard. pls help. Write an equation for cellular respiration. Write an equation for photosynthesis. How are these two equa
ad-work [718]

Answer:

equation for cellular respiration: C6H12O6 + 6O2 + 6H2O → 12H2O + 6CO2

equation for photosynthesis:: 6CO2 + 6H20 + (energy) → C6H12O6 + 6O2

Plants make their own food by photosynthesis. During photosynthesis a plant takes in water, carbon dioxide and light energy, and gives out glucose and oxygen.

Explanation:

8 0
3 years ago
Read 2 more answers
What are the step involved creating a protein
Vlad1618 [11]

first step

A copy is made of one side of the DNA segment where a particular gene is located. This copy is transferred to the cytoplasm.  

second step?

This mirror like copy of a DNA segment is called messenger RNA (mRNA)

third step?

Each group of three bases on the mRNA segment codes for one amino acid.

fourth step?

The mRNA segment is fed through the ribosome.

fifth step?

Molecules of transfer RNA (tRNA) deliver amino acids from the cytoplasm to the ribosome.

sixth step?

The amino acids are dropped off at the ribosome.

seventh step?

The amino acids are joined to make a protein. Usually, one protein is produced for each gene.


7 0
3 years ago
10 points! When looking out of my back door, I see robins, blue jays, finches, crows, hawks and owls all living in the same area
forsale [732]

The possibility for all of the mentioned birds to live all in a same area is because they are all specialized and occupy a certain niche in the food chain, thus not standing in each others ways when it comes to competition for food.

All of these birds have adapted to be able to survive in their respective environment, developing characteristics that will enable them to be superior in something. Through natural selection, the individuals that were performing better, got the chance to mate, thus the offspring was better adapted and stronger in its niche of the food chain.

The robins and the blue jays are birds that are very opportunistic in their food choice, thus giving them greater flexibility and ability to survive, they mostly feed on worms, insects, fruits, vegetables, so they have a big menu.

The finches are specialized in eating nuts and seeds, thus avoiding the competition with the previous two, thus having that food type for themselves.

The owls and hawks are both birds of pray, but the owls hunt mostly at night, while the eagles during the day. Also, the owls prefer to have rodents as their pray, while the hawks are mostly eating other birds, thus not standing in each other's ways.

8 0
3 years ago
Venus is known for its
borishaifa [10]
B. thick atmosphere
You can also use quizlet to look up answers also, I'm in college and they have never failed me.
3 0
3 years ago
Other questions:
  • In a hypothetical situation, a bacterium lives on the surface of a leaf, where it obtains nutrition from the leaf's nonliving, w
    13·1 answer
  • What are two ways molecular modeling can improve our lives
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the following characteristics might be found in an octopus, but not in a sunflower? a. capable of complex and rapid mov
    8·2 answers
  • What is the catalase test? Coagulase test? What does it mean to be: Catalase + Catalase - Coagulase + Coagulase - When working w
    8·1 answer
  • Identify the organelle where photosynthesis takes place. <br><br> B<br><br> C<br><br> D<br><br> E
    10·1 answer
  • The bottom last letter is U. Please help ASAP
    11·1 answer
  • A) Describe the effect of standard of living on tooth decay in town A.
    13·1 answer
  • This is the type of succession that
    5·1 answer
  • What is the haploid number in sea otter?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!