1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
2 years ago
14

A caterpillar has an exoskeleton and feeds on many leaves before it makes a cocoon and becomes a butterfly. Which type of organi

sm is a caterpillar? an autotroph and an invertebrate a heterotroph and an invertebrate an autotroph and a vertebrate a heterotroph and a vertebrate
Biology
2 answers:
Nutka1998 [239]2 years ago
6 0

Answer:

heterotroph and an invertebrate

Explanation:

Animals have been classified into being AUTOTROPHIC OR HETEROTROPHIC based on their nutrition while they are also classified as VERTEBRATE OR INVERTEBRATES based on their skeleton. A heterotrophic animal is one which depends on other organisms to obtain energy or food while an invertebrate is an animal that lacks a vertebrae column or backbone.

In this case, caterpillars are said to feed on many leaves before it makes a cocoon and becomes a butterfly. This means it relies on plants (leaves) for food, hence, it is HETEROTROPHIC. Also, it has an exoskeleton i.e. skeleton present outside the body. This means that it does not possess any bone inside to form the backbone, and hence it is an INVERTEBRATE.

Stels [109]2 years ago
5 0

Answer:

Your answer would be B Could I have Brainliest plz

Explanation:

You might be interested in
Corn planted in a field that has been previously planted with legumes and then plowed under is likely to be
Step2247 [10]
<span>more productive because bacteria living on the roots of legumes fix nitrogen in the soil</span>
3 0
3 years ago
Define diffusion and osmosis
poizon [28]
Diffusion is the movement of substances from high to low concentration

osmosis is the diffusion of water through a semipermeable membrane from high to low water concentration
7 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What is the measure of dissolved solids in the water?
larisa [96]
TDS, Total dissolved solids (TDS) is measured as a volume of water with the unit milligrams per liter
4 0
2 years ago
Need help ASAP!
PSYCHO15rus [73]
I think it’s increase in gene flow
3 0
2 years ago
Other questions:
  • ________ is composed of multiple globular molecules polymerized to form long chains or filaments.
    10·1 answer
  • During which part of the cell cycle are chromosome visible
    14·1 answer
  • Nitrogen is an essential component for the growth of plants but they cannot take it
    10·1 answer
  • In the diagram, what type of mutation is shown?
    13·1 answer
  • What is a scientific theory? The sentences above help to describe a scientific theory. One sentence is not quite
    6·1 answer
  • What question do you have about purberty.
    8·1 answer
  • A scientist is using a species of green algae to study the electron transport chain in photosynthesis. He uses a laser to inacti
    9·1 answer
  • What is the term used to describe any living or nonliving things that influence another living organism? (1 point)
    6·1 answer
  • I'll give you a Brainliest for correct answer
    14·1 answer
  • A scientist is trying to decide whether an organism is Prokaryotic/Eukaryotic. Which information would help make the decision?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!