Answer:
Interphase
Explanation:
Interphase is the G1, or gap 1, phase in which the new cell grows and carries out its functions in the body; the S, or synthesis, phase when the chromosomes replicate; and the G2, or gap 2, phase, when the cell grows further and prepares to divide.
Answer:
Biosphere
Explanation:
The biosphere is the part of the earth that supports life forms. It includes hydrosphere, atmosphere, and lithosphere. Various ecosystems, aquatic or terrestrial, are present in the biosphere. Biotic and abiotic components of a geographical region that interact with each other together make an ecosystem.
The biotic component of an ecosystem includes all the organisms present in it. Organisms may be unicellular or multicellular. All the organisms are made up of one or more cells. Cells are made up of various biomolecules that interact and enable cells to perform the life processes.
What molecule??
I'm assuming the answer would be by diffusion.
The nucleus is in the middle of a cell
and it controls the different part of the cell
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
