1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
2 years ago
6

What is the atomic number of this atom? a b,c O 8 13 09 . 5 4.

Biology
1 answer:
beks73 [17]2 years ago
6 0

6 element ...........

You might be interested in
Which does the work of the immune system?
Feliz [49]
The answer is C. lymphocytes
3 0
3 years ago
Read 2 more answers
New organisms develop from preexisting organisms and ultimately give rise to new species through a process called _____.
kotykmax [81]
That is reproduction..........
8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Millions of years ago, the Sierra Nevada region began to be uplifted along a crack in Earth's crust. The region on the other sid
BabaBlast [244]
D. Fold mountain that appeared wavy I think but just in case check an other answer
7 0
3 years ago
The main goal of science is to _____. answer all questions solve all human problems understand our environment make models of na
Vera_Pavlovna [14]
I think "eat" is the right answer.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Where should the origin of the corona be placed on the phylogenetic tree?
    12·1 answer
  • Why didn’t the three candles stop burning at the same time after the jars were placed? What does this tell us about the rate of
    6·1 answer
  • What did Jan ingenhousz show?
    7·1 answer
  • What is natural selection
    15·2 answers
  • How does the contractile vacuole in a single-celled organism function to maintain homeostasis?
    7·2 answers
  • What would happen if to a substrate molecule if it came into contact with an enzyme active site that matched its specific shap?
    9·1 answer
  • You look out over a field of sunflowers. A farmer has grown the sunflowers to harvest and sell the seeds. Some of the sunflowers
    12·1 answer
  • Organisms that use sunlight directly​
    6·1 answer
  • What is The major function of the cell membrane?
    15·1 answer
  • cross a mom with no hitchhicker thumbs with a dad with hitch hiker thumbs complete the punnet square and detirmine the genetype
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!