1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
3 years ago
5

What is he process of gathering information, organizing it, and using it to adapt to the world

Biology
1 answer:
HACTEHA [7]3 years ago
4 0

Answer:

Cognitive Experience

Explanation:

The process of gathering information, organizing it and using it to adapt to the world is cognitive experience. We collect data and information by understanding it and then try to simplify/interpret in a way that's more organized and easy to understand. When we put this knowledge to the real world by utilizing it, we're using our <em>cognitive experience </em>from the past and applying it to the current situation.

It's like a set of mental procedures which is the way the brain sees, learns, recalls, and thinks about all the details they notice with their five senses.

You might be interested in
DNA is shaped like a twisted ladder. What do we call this shape/structure? pick the the correct answer.
Harrizon [31]

Answer:

The answer is 3. Double Helix.

7 0
2 years ago
What are the proteins used in active transprot called
Ksju [112]
Carrier proteins are the proteins in active transport
5 0
2 years ago
Which of the following is not characteristic of smooth muscle? A) The striations are due to the orderly arrangement of actin and
Tems11 [23]

Answer:

A) The striations are due to the orderly arrangement of actin and myosin

Explanation:

Smooth muscles are non-striated involuntary muscles which are found in the walls of stomach, urinary bladder, blood vessels...Smooth muscle tissue is composed of spindle-shaped muscle cells with single central nucleus. Like the other two type of muscles (cardiac and skeletal), smooth muscles also have four main functions:

  • Contractility-ability to contract. In the case of skeletal muscles it is voluntary, while in cardiac and smooth muscles it is unconscious.
  • Excitability-ability to change  membrane potential usually by the influence of nervous impulse.
  • Extensibility-the capacity to lengthen
  • Elasticity-ability to change its length and then return to previous.

7 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Can you help, please?
chubhunter [2.5K]

Answer:

D

Explanation:

8 0
2 years ago
Other questions:
  • Plants tend to grow toward air with higher humidity because of _____.
    12·2 answers
  • Why is the SI system used for scientific measurement rather than the metric system
    6·1 answer
  • What is the function of the cell membrane? A. To determine what materials can enter or leave a cell B. To package proteins in an
    12·2 answers
  • Which protist is multicellular and can primarily be found in cool marine climates?
    10·2 answers
  • What happens during a cross-over event?
    9·1 answer
  • Bile is produced by the liver and concentrated and stored in the ?​
    9·1 answer
  • How might a farmer use artificial selection to increase crop yields over<br> time?
    12·1 answer
  • What is the name of the cyclone that came today 26th of may 2021 in jharkhand.​
    14·1 answer
  • Question 18 OT 25
    9·2 answers
  • Aaj made a Venn diagram to compare and contrast the two stages of cellular respiration.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!