1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hoa [83]
3 years ago
11

plant reproduction requires the presence of auxins, as well as a large amount of sugar for energy. which two main plant tissues

work together to release sugar and carry hormones so that reproduction can take place?
Biology
1 answer:
Fittoniya [83]3 years ago
5 0

Answer:

The two main plant tissue that works together to release sugar and carry hormones so that reproduction can take place are: The ground and the vascular tissue.

Explanation:

You might be interested in
In a species of insect, wing length is determined by a single gene, for which there are only two alleles. in a population of 150
Phantasy [73]
I believe the answer is c. because of Darwin's theory of evolution..
3 0
3 years ago
Read 2 more answers
The majority of a forensic scientist's time is spent _____.
umka21 [38]
In a lab analyzing evidence.
3 0
3 years ago
Read 2 more answers
Question 3 (1 point)
Mumz [18]

Answer:

False

Explanation:

Mass of Particle: Heavier particles will move more slowly and so will have a slower rate of diffusion. Smaller particles on the other hand will diffuse faster because they can move faster.

4 0
3 years ago
Earth is tilted at a 23.5 degree angle. Explain how this causes the equator to be hot and the poles to be cold.
Agata [3.3K]

Answer:

sunlight

Explanation:

at the angle the earth is at, sunlight hits the equator almost directly, as well as the equator being closer to the sun.

8 0
3 years ago
An asynchronous clr' signal (multiple answers can be correct, select all that apply. you will get partial credit in case of miss
stiv31 [10]

Correct Question:

An asynchronous counter signal:

Answer:

overrides the clock-gated input signal(s).

Explanation:

An asynchronous counter signal normally overrides the clock-gated input signal(s).

An asynchronous counter is a type of counter whereby each flip-flop output serves as the clock input signal for the next flip-flop signals and preset can be used to override the clock-gated input signal(s).

7 0
3 years ago
Other questions:
  • In the early 1900s, experiments were conducted on two caterpillar species. The members of the two species
    5·1 answer
  • During protein synthesis which part of RNA is joined together to form a sequence for a functional protein? Exons, introns, both
    10·2 answers
  • "Some people are tempted to say that the more genes an organism has, the more advanced it is. Discuss this idea: what kinds of a
    15·1 answer
  • DNA copying can be done by bacteria or by using
    10·2 answers
  • PLEASE HELP!! I’m very confused
    7·1 answer
  • 5. Which is an example of an epidemic?
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Explain why a scientist should or should not change a theory based on one experiment?
    12·1 answer
  • I need help with this school is about to end and this needs to be turned in
    13·2 answers
  • Using the letter l for Lovingston’s and I for non Lovington,s, determine kites and dots genotypes and then complete the punnet s
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!