1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andre [41]
3 years ago
13

How does kleptopredation relate to science?

Biology
1 answer:
Anastaziya [24]3 years ago
6 0
Wow um define that big word
You might be interested in
Giant tortoises that live on Española Island interact with other species in their environment. Humans have, however, brought new
Zolol [24]

Answer:

C. introduced species

Explanation:

The species we introduced caused problems for the turtles on the island.

5 0
3 years ago
Read 2 more answers
Which best describes how food availability affects the carrying capacity of an area?
ruslelena [56]

Answer:

I believe your answer would be "B"

Explanation:

If the food supply increases for a spider, they will reproduce faster, creating more food for the next animal in the food chain, and then that animal will reproduce faster, creating more food for the next animal, and so on! This would create more room for more animals because they can reproduce faster and create more all together.

Have a blessed day, please mark BRAINLIEST if correct! :D

8 0
3 years ago
What peculiar feature did Darwin find in the tortoises on the Galapagos Islands?
Yuri [45]
B. They had adapted to their surroundings. 

Adaption observed by Darwin on the Galapagos Islands also lead to the idea of Natural Selection: that those better suited to survive in their environment will continue to live and reproduce, passing on the traits to help the descendants survive as well.<span />
8 0
3 years ago
Read 2 more answers
What is the process of Asexual reproduction? Honey Bees
Vlada [557]

Answer:

ASEXUAL

female worker bees are able to reproduce asexually: they lay eggs that are essentially fertilised by their own DNA, which develop into new worker bees.  The team sequenced the entire genomes of a sample of Cape bees and compared them with other populations of honeybees that reproduce normally.

SEXUAL

The typical story of reproduction is that males and females of an animal species do it sexually. Generally, that's what honeybees do, too. Sperm from a male drone fertilizes a queen's eggs, and she sends out a chemical signal, or pheromone, that renders worker bees, which are all female, sterile when they detect it.

Explanation:

4 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Each person Jose has met in Bakersfield so far has been very strange. Jose now believes everyone who live in this town must be s
    11·2 answers
  • Which of the following statements does NOT relate to the nitrogen cycle?
    10·1 answer
  • The body of a composition
    14·2 answers
  • Most animals use a circulatory system in which blood or a similar fluid is circulated among body tissues. Which animals do NOT d
    9·1 answer
  • What does it mean if someone is malnourished?
    10·1 answer
  • Please help with punnet squares problem! I'm not understanding what the answer is thanks
    7·1 answer
  • What structure pull the chromosomes apart
    13·2 answers
  • Which element would enable a geologist to determine the absolute age of the rock?
    10·2 answers
  • Acromegaly is the result of decreased levels of growth hormone in adulthood<br><br> True or false
    15·2 answers
  • PLEASE HELP QUICK, 100 POINTS AND BRAINLIST.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!