1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
15

What are the three basic decisions that an economic system must make?

Geography
1 answer:
nataly862011 [7]3 years ago
8 0
There are three types of basic economic systems and they are traditional, command and market.
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
The British have left the European Union recently due to what concerns?
vivado [14]

Answer:

Other countries financial issues were hurting their economy

Explanation:

The European Union is an amalgamation of different countries under one body in-order to promote unique economic and developmental goals. And also, it ensure single and free movement of goods and people without restrictions whatsoever.

<em>For the British, their leaving the European Union (commonly called Brexit) is as a result of the financial issues of other smaller countries hurting their economy. The wanted to be in charge of their economy going by the fact that, their currency is far better and valuable than the Euro.</em>

3 0
3 years ago
Instability and violence between feuding warlords in the 1990s made Somalia an example of a(n) __________. A. parliamentary repu
solong [7]
The answer is C. thanks.
6 0
4 years ago
Read 2 more answers
Which elements of an op-ed are evident in the excerpt?<br> Select three options.
xeze [42]

Answer:

C/D/E

Explanation:

The op-ed comes to a conclusion for the audience.

The op-ed includes first-person pronouns.

The op-ed attempts to persuade the audience.

8 0
3 years ago
At what temperature did water freeze on Earth 1 billion years ago?
pantera1 [17]
Freezing point of the water is innate property. Therefore, I would say that the freezing point of water from 1 billion years ago would still be the same as to what temperature the water would freeze today. Thus, I choose letter D. 0°C. 
7 0
3 years ago
Other questions:
  • The hydrosphere and lithosphere meet _____. on mountaintops inside glaciers at volcanoes along shorelines
    11·2 answers
  • What will happen to human and earth if weathering do not exist??
    5·2 answers
  • Que es el espacio?muchas gracias
    8·1 answer
  • What is the tallest mountain in the uk
    12·2 answers
  • What is the river west of the appalachians that forms a border between indiana and kentucky
    11·1 answer
  • PLS HELP, I WILL REWARD BRAINLIEST ASAP!!
    14·1 answer
  • How did John Quincy Adams influence U.S. foreign policy?
    7·2 answers
  • Historically, most immigrants came from _______________and settled in the Northeast.
    6·1 answer
  • Which of the following rates measures how many people are moving to a country?
    15·1 answer
  • Name the main source of water in hydrogen<br>​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!