1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tju [1.3M]
3 years ago
15

Why are humans most likely to form communities

Biology
2 answers:
tester [92]3 years ago
7 0

Because humans want to help the world in their own way and want to help in a way that will promise to benefit the world

spin [16.1K]3 years ago
4 0

Answer:

As they need to meet the requirements of the individuals and the groups.

Explanation:

Humans mainly form communities in order to meet the requirements of the individuals and the groups. It is the requirement for the social well-being of the individual. There are some requirements of a group of people in order to thrive in society. They need to associate with each other in order to stay happy. They need to associate in order to survive for the objective of reproduction, food, resources, communication, and various other things. Thus, to meet the need of a group of people the humans need to form communities.

You might be interested in
A small-for-gestational-age (sga) newborn who has just been admitted to the nursery has a high-pitched cry, appears jittery, and
Juli2301 [7.4K]
<span>The nurse should expect complications due to hypoglycemia. People who suffer from hypoglycemia have low blood sugar and some symptoms include shaking, crying, sweating, heart problems and many more things. The baby has suffered from two of these things, which were crying and shaking, so hypoglycemia should be considered.</span>
7 0
4 years ago
How did planetsmals become planets? A) they broke apart into smaller chunks
Varvara68 [4.7K]
They Widley accepted theory of planet formation, they so-called palnetsmals hypotheses, the Chamberlin--Moulton  planetesimal<span> hypothesis and that of Viktor Safronov, states that </span>planets<span> form out of cosmic dust grains that collide and stick to form larger and larger bodies.</span>
7 0
3 years ago
I need help with this please
Karolina [17]

Answer:

The lungs look like smokers lungs on the right

8 0
3 years ago
What causes a sound wave to echo in an empty house?
scZoUnD [109]

Answer:

I'd say the answer is B. reflection of waves off smooth walls

Explanation:

5 0
3 years ago
Read 2 more answers
Which is a change early farmers made to their environment? A. They planted orchards. B. They burned undergrowth. C. They created
tatuchka [14]
B, they burned undergrowth
7 0
3 years ago
Other questions:
  • What are the roles and relationships among producers?
    5·2 answers
  • ***EASY QUESTION, LOTS OF POINTS!!*** In pea plants, the allele for purple flowers (P) is dominant to the allele for white flowe
    6·2 answers
  • Which process describes the discharge of waste from the body? Absorption Chemical Elimination Mechanical
    8·2 answers
  • Please help
    10·1 answer
  • An igneous rock is light in color and has extremely coarse grains. What is the most likely origin of the rock?
    11·1 answer
  • Atoms are built around a ------- containing both -------- and-----------------
    7·2 answers
  • Help me with this and I shall mark you the brainiest!!
    7·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • A fire totally destroyed a forest. It will gradually undergo “succession.” What does this mean?
    12·1 answer
  • If the amount of food resources increases the population of an animal would [FILL BLANK]
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!