1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Contact [7]
3 years ago
5

Four times a number, subtracted from nine, is twice the number. How do I solved this?

Mathematics
1 answer:
Natalija [7]3 years ago
5 0

4x - 9 = 2x


Solve for x.

4x = 2x + 9

2x = 9

x = 4.5

We can plug 4.5 into the original equation to verify if it's correct.

4x - 9 = 2x

4(4.5) - 9 = 2(4.5)

18 - 9 = 9

The equation is true, and so x = 4.5

You might be interested in
Unknown angle problems (with ale<br> Solve for I in the diagrarn below.<br> (24 + 45)<br> f<br> TE
astraxan [27]

Answer:

x = 45

Step-by-step explanation:

The angles with (2x + 45) and x are supplementary angles, meaning they add up to 180°. We can write this statement as an algebraic equation of 2x + 45 + x = 180 and solve it.

Step 1: Combine like terms.

  • (2x+x)+45=180
  • 3x+45=180

Step 2: Subtract 45 from both sides.

  • 3x + 45 - 45 = 180 - 45
  • 3x = 135

Step 3: Divide both sides by 3.

  • 3x/3 = 135/3
  • x = 45

Step 4: Check if solution is correct.

  • 2(45) + 45 + 45 = 180
  • 90 + 90 = 180
  • 180=180

Therefore, x = 45.

Have a lovely rest of your day/night, and good luck with your assignments! ♡

8 0
2 years ago
Absolute value of _3
Oliga [24]
Three. For these questions, ignore the positive or negative sign.
5 0
3 years ago
Read 2 more answers
Need Answer for this one still!
love history [14]
The answer would be C: 2/3
There are 4 out of 6 letters that aren’t vowels (BMPC)
And 4/6 = 2/3
5 0
3 years ago
Read 2 more answers
Help for
Fed [463]
3 x 5 x 8 =15 x 8 = 120
5 0
3 years ago
Jane randomly opens a 24 page magazine. find the probability that she would open it up to a page that is a prime number.How many
prohojiy [21]
The probability that Jane opens a prime page in a 24-page magazine is 0.375. There are 9 prime numbers between 1-24 and they are: 2,3,5,7,11,13,17,19, and 23. To calculate, Probability = Events/Number of Outcomes which is 9/24 = 0.375. Hope this helps.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Please help me with this (ASAP)
    7·1 answer
  • Can someone please help me! I have a quiz tomorrow and I’m frustrated!
    14·1 answer
  • Does the order of the numbers in an ordered pair matter when naming a point? Can that point be represented by more than one orde
    11·1 answer
  • Help asap A triangle has angles D, E, and F. Which of the following could not be a set of
    11·1 answer
  • Which fraction is equivalent to 2/-6
    12·1 answer
  • sharice bought 8 songs that cost 0.79 each. She also bought an album. The total price of these items was 15.21 what was the pric
    11·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Calcular el área total del cubo si s=5√2
    15·1 answer
  • Hello if you're able to answer this question help me and provide work as well, Thank you.
    11·1 answer
  • How many Americans died from the Spanish Flu ?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!