The first one is oxygen and then respiration
Rayleigh wave is the type of seismic wave highlighted in the image. This answer
has been confirmed as correct and helpful.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
11- the number of protons is the same as the atomic number
The answer to the question is A
