1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
murzikaleks [220]
3 years ago
8

Cross a Heterozygous Type A with a Heterozygous Type B? What genetic terms best describes the genotypes of the offspring?

Biology
1 answer:
ahrayia [7]3 years ago
6 0
Draw a box. On the vertical side of the box write A and O

On the horizontal side write B and O

Take each letter and combine it with the two letters in the other plane and write them in the box.

AB AO OB OO and BA BO OA OO

Knowing that the A and B genes are dominant … you get the following children probabilities:

AO OA are A’s

OB BO are B’s

AB BA are AB’s

OO and OO are O’s

THE TWO PARENTS CAN PRODUCE all the blood types of the ABO SYSTEM.
You might be interested in
In hamsters the allele for a brown coat color (B) is dominant over the allele for a tan coat color (b). If a tan hamster is cros
almond37 [142]

Answer: 50% brown and 50% tan

2/4 brown and 2/4 tan

Explanation:

the brown parent is: Bb

the tan parent is bb

when crossed the out come will be: Bb, bb, Bb, bb

4 0
3 years ago
You are given a single stranded piece of DNA that looks like the image below. What are the bases, in order, that should match (c
MatroZZZ [7]
The answer is the first one
3 0
3 years ago
The older crust in this case would be at point D, the newest at point A.
umka2103 [35]

Explanation:

New ocean crust is formed at the mid ocean ridges. The new crust is then pushed away from the ridge as newer crust comes to the surface. The ocean crust then spreads out enlarging the ocean. The farer away from the ridge the ocean crust is the older the crust

3 0
3 years ago
How does natural selection affect animals
ivann1987 [24]

Animals are affected by Natural Selection because Inherited characteristics affect their likelihood of survival and reproduction.
7 0
4 years ago
Read 2 more answers
2. The magnitude of the action force is the _____________________________as the magnitude of the reaction force. For instance, i
elena-s [515]

Answer:

Same, 50N

Explanation:

According to Newton's third law, any force exerted on an object is exerted back with the same magnitude. The magnitude of the action force is the same as the magnitude of the reaction force. In the example, the chair would be pushing back with a magnitude of 50N.

I hope this answer helps.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Martin’s science class is having a discussion about inherited plant traits. He and three of his classmates have offered their op
    7·1 answer
  • How does diet and exercise affect blood lipid levels?
    6·1 answer
  • Which of the following organic molecules are most closely related to proteins? sugars amino acids fatty acids nucleotides​
    11·1 answer
  • PLS HELP!!
    13·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Fern is nutrionally a...
    10·2 answers
  • Capital of the vijanyana empire,​
    15·2 answers
  • Mixing milk and vinegar makes curds. *
    14·1 answer
  • Which contributes most to the development of drug-resistant bacteria?
    15·1 answer
  • Which is the most likely correct sequence of events involve in the evolution of early life?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!