Answer:
<h2>Rule of Law </h2>
is a Political Ideology
It stands for all human being equality and give justice to the abused. This states that a person is independent, and have rights.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
Yes cuz it been in the same area for decade
<span>The bruise slowly disappears as the arm heals.
</span>
<span>The two identical daughter cells resulting from mitosis and cytokinesis are identical in the following ways:1. Mitosis occurs when the nucleus of the cell divides into two identical nuclei, each with the same type and number of chromosomes. The cell's DNA is duplicated during this phase. Sometimes the cell's DNA isn't copied properly resulting in cancer-type cells. 2. Cytokinesis is when the cytoplasm divides into two identical daughter cells. Each cell is genetically identical and both are a similar size.
</span>
