1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalka [10]
3 years ago
5

What will happen to a population of predators if there is a sudden, temporary increase in the number of prey?

Biology
2 answers:
alina1380 [7]3 years ago
5 0
I think the answer is the population of predators will increase continuously.

Dafna11 [192]3 years ago
3 0

The population of predators will increase first and then decrease slowly.

You might be interested in
DNA replication results in two DNA molecules, _________________________. Thus replication is _________________________.
kvasek [131]

Answer:

consisting of one new and one old chain of nucleotides.

is described as semi-conservative, half of the chain is part of the original DNA molecule, half is brand new.

5 0
3 years ago
Why is evolution considered a theory and not a law
cluponka [151]
Theories explain phenomena, whilst laws are generalizations which characterize them.
3 0
3 years ago
A(n) ________ is an interview conducted by a trained moderator among a small group of respondents in an unstructured and natural
monitta
A focus group is an interview conducted by a trained moderator among a small group of respondents in an unstructured and natural manner.
3 0
3 years ago
Which is one of the bases found in DNA?
qwelly [4]
The answer is A. Adenine
3 0
3 years ago
Which model best describes the path of energy during photosynthesis?
Hatshy [7]

Answer:

the answer is A!

Explanation:

i did the exam on A PE X

4 0
3 years ago
Other questions:
  • A chance mutation causes a cheetah to be born with very short front limbs. What will be the most likely result of this mutation?
    7·1 answer
  • How are seed plants diffrent from nonvascular plants
    14·1 answer
  • What is the inheritance pattern for many different phenotypes from one pair of alleles?
    10·2 answers
  • Which is a component of a biosphere
    11·1 answer
  • What is the relationship between Earth’s surface features and Earth being called the “blue planet”? (1 point)
    5·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Help with ALL of the questions, please when answering include which number
    8·2 answers
  • as a result of ach stimulation, calcium ions are released from the ______ of the sarcoplasmic reticulum.
    11·1 answer
  • A common inhabitant of human intestines is the bacterium escherichia coli. a cell of this bacterium in a nutrient-broth medium d
    10·1 answer
  • What is the name for the rafflesia's organism
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!