1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DanielleElmas [232]
2 years ago
8

What rights are included in the Miranda warning?

Law
1 answer:
artcher [175]2 years ago
6 0

Answer:

hat Are Your Miranda Rights?

The Miranda warning is the four rights:

1. people have the right to remain silent

2. Anything you say can and will be used against you in a court of law

3. You have the right to an attorney

4.If you cannot afford an attorney, one will be appointed for you

You might be interested in
What are the meaning of accident? what is required for accident to be accepted​? Explain
Andrews [41]

Answer:

Something happening to you or others that you did nonpurposely

5 0
2 years ago
According to V.O Key Jr. the three primary roles of American political parties according to Key are:
Tomtit [17]

The most accessible role of political party of America according to the V. O. Key Jr., is the voting part where voters uses shortcuts to identify the candidates implying with similar or same ideology and policy.

Answer: Option 2

<u>Explanation: </u>

Val dimer Orlando Key Jr. was a political scientist of American origin, who gave the political theory and studied politics closely identified or specified many roles and responsibility.

Of all those, most important part which is accessible to the public which pertains to involvement of public is the independent voting system, as listed under option 2.

3 0
3 years ago
Have any crimes been committed? if so which crimes and by whom?
velikii [3]

Answer:

yes

Explanation:

all of them

7 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
What meant by the rule of law​
jonny [76]

the principle that all people and institutions are subject to and accountable to law that is fairly applied and enforced; the principle of government by law.

7 0
3 years ago
Other questions:
  • The history of policing in the us extends back to
    8·1 answer
  • Please help.....ASAP
    12·2 answers
  • What role did the Declaration of Independence play in the country’s founding? It granted rights to individuals. It announced the
    12·1 answer
  • How does the Fourth Amendment protect individuals from unreasonable searches and seizures by the police? When are there exceptio
    5·1 answer
  • What can the president be impeached for
    10·2 answers
  • Medical expenses, non reimbursed work expenses, donations to charity, property taxes, and mortgage interest are all examples of_
    11·2 answers
  • Which of the following powers is reserved for the state governments?
    5·1 answer
  • How many seats are on the Supreme Court?
    5·2 answers
  • Do you think you would be able to memorize all the 10-codes on the list, or would you have to refer to a chart?
    7·1 answer
  • If you get stopped by a cop when you are walking on the sidewalk do you have to identify yourself?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!