1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
12

The embryonic feature that gives rise to the anterior and lateral horns of gray matter is the _____ plate.

Biology
1 answer:
Sindrei [870]3 years ago
5 0
The answer is called the basal plate. Hope this helps.
You might be interested in
The interdependence of body systems is essential because
QveST [7]
 c<span>: The interdependence of body systems is essential because all systems work together to maintain homeostasis.</span>
6 0
3 years ago
If you "pass your genes along" to your offspring, can't you run out of genes?
Colt1911 [192]

Answer:

No

Explanation:

genes are part of your own dna you don't run out of dna

8 0
2 years ago
Read 2 more answers
8. Which process is responsible for destroying shorelines along seawalls near urban areas?
PolarNik [594]

Answer:

B

Explanation:

Erosion displaces sediment.

6 0
3 years ago
Read 2 more answers
How is cellular respiration, both anaerobic and aerobic, instrumental in muscle contractions?
Dmitry [639]
<span>Control of physiological activities. Homeostasis involves the steady state and regulation of the body's internal environment. Irritability is the ability to respond to a stimulus.</span>
3 0
3 years ago
Read 2 more answers
What are the three types of symbiotic relationships? with definitions please
Licemer1 [7]

Answer:

The three types of symbiotic relationships are mutualism, parasitism, and commensalism. In mutualism, both organisms gain something, in parasitism, one organism gains and the other loses, and in commensalism, one gains and the other doesn't gain or lose

5 0
3 years ago
Other questions:
  • Robert and Tonia are on a date. Tonia is smiling and expressing herself in ways that indicates that she likes Robert. On the oth
    9·2 answers
  • Is neon different from oxygen?And how is it different? Please explain.
    14·1 answer
  • What is meant by the term epistasis? Distinguish between epistasis and dominance. Do not use examples in answering this question
    15·1 answer
  • Which is a potential negative consequence of using genetically engineered medicine?
    11·2 answers
  • Define genus and species. how are they related to the binomial nomenclature of an organism?
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which describes the role of a skunk?
    12·2 answers
  • Which would most likely be found as a petrified fossil form?
    11·2 answers
  • 36. What are the two smaller tubes that branch off of the trachea?
    15·1 answer
  • Easter Island is described as having a mild climate and fertile soil, which should be favorable for a diversity of organisms. Wh
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!