1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
13

What are the major sources of evidence for evolution how does each support the theory of evolution?

Biology
1 answer:
Valentin [98]3 years ago
6 0

Answer:

DNA is one of the major sources might be wrong tho

Explanation:

DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are. Biogeography. The global distribution of organisms and the unique features of island species reflect evolution and geological change.

You might be interested in
The adjustable opening in the center of the eye that helps control the amount of light entering the eye is called the __________
kotykmax [81]
The iris controls the amount of light entering the eye.
7 0
4 years ago
Read 2 more answers
As new seafloor is created in a Rift Valley, old sea floor is melted back into magma.which process accounts for this melting
zimovet [89]
Subduction is the answer.
4 0
3 years ago
What is needed for natural selection to occur? Select all that apply.
DIA [1.3K]
These are the answers to thisA C D E
5 0
4 years ago
Select the variables that you would predict to be regulated by the body using a homeostatic mechanism.
erik [133]
The variables that i would predict to be regulated by the body using a homeostatic mechanism are; amount of pressure which moves fluids in the body; amount of heat in the body; amount of water in the body;
Homeostasis is best described as the maintenance of a stable internal environment in spite of a changing external environment. 
8 0
3 years ago
PLEASE HELP WILL MARK BRANLIEST!
Novay_Z [31]

Answer:A. decomposers

Explanation: A decomposer is an organism that decomposes, or breaks down, organic material such as the remains of dead organisms. Decomposers include bacteria and fungi. These organisms carry out the process of decomposition, which all living organisms undergo after death.

4 0
3 years ago
Other questions:
  • Which two processes in the carbon cycle are also parts of the oxygen cycle?
    6·1 answer
  • A static character _____.
    8·2 answers
  • A scientist observed a fungus and recorded what she saw:
    8·1 answer
  • Two proteins associated with a rare neurodegenerative disorder have been sequenced. Protein A contains many polar amino acids wi
    7·1 answer
  • Cooler denser air produces an area of _________pressure, and moves in under rising air.
    13·1 answer
  • During which time frames was there the greatest rate of change in atmospheric C02 concentration
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 65 g of sugar is dissolved in 750ml of water. What is the % concentration of the solution?
    13·1 answer
  • This is due today pls help
    9·2 answers
  • 1.Kim wanted to determine how temperature affected the growth of E. coli, a common intestinal bacteria in humans. The normal bod
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!