1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
9

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Biology
1 answer:
marysya [2.9K]3 years ago
6 0
It should be
AGATACCATGGTTACCCGGTTCCA
You might be interested in
A new screening test for Lyme disease is developed for use in the general population. The sensitivity and specificity of the new
Ahat [919]

Answer:

The predictive value of a positive test is:

B. 18.2%

Explanation:

5 0
3 years ago
Lysosomes use what to break down foreign matter and dead cells?
ladessa [460]
I believe they use enzymes
5 0
3 years ago
commensalism is when one organism ________ and the other is ___________. a.benefits; harmed b. benefits; unaffected c. benefits;
lara [203]
Commensalism is when one organism B. Benefits and the other is unaffected.
6 0
3 years ago
Which of the following is a good reason to use a simulation in an experiment?
Komok [63]
C. To predict the outcome of an event in the real world
8 0
3 years ago
Identify which of the following are eukaryotes. 1. Algae 2. Bacteria 3. Viruses 4. Prions 5. Protozoa
Ierofanga [76]

Answer:

1,5......Algae and protozoa

5 0
3 years ago
Other questions:
  • A certain bone is part of the axial skeleton and protects one off the vital organs located in the chest area. which bone is it l
    11·1 answer
  • A woman whose sister tested positive for a specific mutation in the BRCA1 gene, which increases the risk for breast and ovarian
    6·1 answer
  • An _ is a characteristic of matter that can be observe as it changes to a different type of matter
    10·2 answers
  • Under Weber's law, we'll notice a stimulus difference such that it will be a constant proportion of the intensity of the initial
    14·1 answer
  • Which term describes an inherited or innate trait that allows an organism to survive in its particular environment?
    12·1 answer
  • Please select the word from the list that best fits the definition
    14·1 answer
  • A swimming pool holds 2,640,000 quarts of water.<br><br> How many gallons does it hold?
    15·1 answer
  • Describe sporangium fungi and club​
    13·1 answer
  • Задание 1: a) по рисунку определите особенности формирования мужских и женских гамет у животных и растений в фазах митоза I и II
    7·1 answer
  • Which body systems help the respiratory system move gases between the lungs and the cells of the body?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!