1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
9

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Biology
1 answer:
marysya [2.9K]3 years ago
6 0
It should be
AGATACCATGGTTACCCGGTTCCA
You might be interested in
the illustration shows a scale model of a pond in a local park the scale is 1:21 the model shows the pond is 3 cm deep. How deep
pentagon [3]

Answer:

Option D, 63 cm

Explanation:

The scale of model is of local park  is 1:21

This means that each dimension of the model is 21 times smaller than the actual park (to be developed in future)

Given -

Depth of the pond = 3 centi meter

Depth of the real pond will be 21 times of the depth of the model.

Thus , real pond's depth is equal to

= 3 * 21\\= 63 cm

Hence, option D is correct

6 0
3 years ago
Read 2 more answers
Beanie Eyelash is a celebrity who does not have a widows peak, while Chris Hemsworth is a celebrity who does. What is a widows p
weqwewe [10]
I believe the answer to this one is (A) Single Gene Traits. I searched it up and it says “Widow’s peak occurs when the hairline forms a distinct point in the center of the forehead. Widow’s peak is controlled by a dominant allele (W).”
3 0
3 years ago
First, describe why an animal is considered a system. Then, explain why an animal is not considered a technological system. ▲
vaieri [72.5K]
A system is a group of organs that work together and provide an organism with an advantage for survival. It is the most complex organization in your body and the final level of the progression from cells to tissues to organs and then systems.
8 0
3 years ago
A positive ion with two units of charge has 10 neutrons and 8 protons. the ion also has
yuradex [85]
Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.
Below are the choices that can be found from other sources:

<span>a. 10 electrons
b. 6 electrons
c. 12 electrons
d. 16 electrons
e. 8 electrons
</span>
Answer is 6 electrons. <span>The part with the two units of + charge is a cation; the part with the unit of - charge is an anion.</span>
4 0
3 years ago
Determine how tRNA is used when cells build proteins ...?
alexdok [17]
<span>tRNA carries a single amino acid to the ribosome. 
It fits the codon on the mRNA in the ribosome with it's anti-codon. 

The ribosome has peptidyl-transferase activity which catalyses the peptide bond between 2 amino acids on 2 tRNAs in the ribosome. 

One tRNA is released and then picks up another amino acid depending on its anti-codon.


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
</span>
3 0
3 years ago
Other questions:
  • PLEASE HELP WILL GIVE BRAINLIEST TO CORRECT ANSWER
    6·2 answers
  • Which is used to measure the length of a bicycle trail? A. km B. kg C. kmi D. kL
    12·2 answers
  • If retinal detachment occurs in the macula lutea, one can predict that there would be a significant loss of ______.
    6·1 answer
  • Which job must enzymes do before replication can begin?
    10·1 answer
  • What is the mass of the green cone? <br> A. 542.0 g<br> B. 540.2 g<br> C. 500 g<br> D. 480 g
    8·1 answer
  • True or False. An action potential can exist when both sides of the cell membrane have the same charge.
    7·2 answers
  • Fossils are the ____? ( 1 point )
    15·1 answer
  • List and describe three methods of point pollution control.<br> 1.<br> 2.<br> 3.
    10·1 answer
  • What is the importance of metalimnion
    9·1 answer
  • How long does sweetened condensed milk last in the fridge?.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!