1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
9

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Biology
1 answer:
marysya [2.9K]3 years ago
6 0
It should be
AGATACCATGGTTACCCGGTTCCA
You might be interested in
in which case dd the us supreme court establish the precedent allowing civilians to bring a suit against federal law enforcement
Phoenix [80]

The US supreme court establish the precedent allowing civilians to bring a suit against federal law enforcement officers and other government employees under 42 US section C 1983 during the case of WEBSTER BIVENS VS 6 UNNAMED FBI AGENTS and suit against federal law enforcement.

<h3>What is the law under 42 US section C of 1983?</h3>

Section C of 1983 gives individuals the right to sue the federal and state government employees and law enforcement officers acting under color of state law for violations of their civil rights.

For this section, its purpose was derived from the case between Webster Bivens and 6 unnamed FBI agents after a complaint that these agents made a warrantless entry to search his apartment.

Learn more on US federal laws here: brainly.com/question/25912245

#SPJ1

5 0
1 year ago
which pattern of inheritance is responsible for a wide range of phenotypes that result from the individual organisms having many
Stella [2.4K]
The answer is polygenic inheritance.

Polygenic inheritance is responsible for traits that are controlled by two or more genes. It is also called multiple gene inheritance. Examples of polygenic inheritance are height, weight, skin color, eye color.
Since a great number of genes control one trait, it is expected that each one has<span> a relatively small effect</span>
6 0
3 years ago
John, a 19 year old boy, wanted to figure out why he wasn't sleeping well at night. He normally and heads to bed by 11 pm and wa
Katarina [22]

Answer:

The Pepsi he drinks at 10 pm

Explanation:

Pepsi is a caffeinated drink that has caffeine in it. Caffeine is a stimulant which means it keeps the body awake and alert. Caffeine works by mimicking adenosine. Adenosine is produced by neuron cells and when it binds to its own receptors (autocrine signaling) it triggers the neurons cells to continue firing. As the adenosine levels fall as the day progresses, the brain is signaled that it is time rest. Adenosine levels are at the lowest when its almost bedtime. However, when Jon takes Pepsi, the caffeine in it bind to the adenosine receptors and make the brain neurons to keep ‘firing’.

6 0
3 years ago
Sperm are the only human cells to have _____.
Delvig [45]

Answer:

flagella.

Explanation:

6 0
4 years ago
Can a person’s genotype be determined by their phenotype? Why or why not?
julsineya [31]

Answer:

No, a person's genotype cannot be determined solely by their phenotype as many genes in our genome do not get expressed.

Explanation:

4 0
4 years ago
Other questions:
  • What are the characteristics of cellulose
    5·1 answer
  • The plants that form the basis of rain forests are _____.
    6·2 answers
  • How is ATP produce during photosynthesis?<br> And in cellular respiration?
    14·1 answer
  • Drag the terms on the left to the appropriate blanks on the right to complete the sentence. Terms may be used more than once.
    14·1 answer
  • Sarah and John are having a discussion on genetic diversity. Sarah believes that it happen over a long period of time. John it h
    12·1 answer
  • What is one purpose for the peer-review process in scientific research?
    6·1 answer
  • What is photosynthesis​
    9·2 answers
  • Let's look at the original hypotheses arising from the original question: "Does the size of the
    13·1 answer
  • Which statement about an ecosystem is incorrect?
    12·1 answer
  • Which is not true about plant cell walls?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!