1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
2 years ago
9

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Biology
1 answer:
marysya [2.9K]2 years ago
6 0
It should be
AGATACCATGGTTACCCGGTTCCA
You might be interested in
Which type of metabolic reaction is an example of a process that does not require coupling to atp hydrolysis?.
Licemer1 [7]
B oxidation of fatty acids
4 0
2 years ago
Que es la biogenesis
ira [324]

La biogénesis es el proceso fundamental de los seres vivos que producen otros seres vivos. Ejemplo: una araña pone huevos de los que saldrán más arañas. La biogénesis es aquel principio según el cual la vida solamente se origina de una vida preexistente (que ha existido antes).

3 0
3 years ago
What occurs during the transition from stage A to stage B in the picture?
nika2105 [10]

Answer:

i think its something to do with circle of life or stages of growth

Explanation:

5 0
3 years ago
In 1939, the use of DDT (a powerful synthetic chemical) as an insecticide was discovered. The United States adopted its widespre
olganol [36]
The answer is <span>insect and pest populations decreased.
</span>

DDT (dichlorodiphenyltrichloroethane) was used as an insecticide which is a substance used to kill insects. That resulted in decrease in insect and pest populations. It is a persistent and non-degradable insecticide, but as well organic pollutant readily accumulated to soils and consequently affects organisms.
7 0
2 years ago
Read 2 more answers
A population of rabbits inhabits an island that has an active volcano. The volcano erupted and covered the island destroying mos
lorasvet [3.4K]

Answer:

Few rabbits will be able to find food, so the population will die off and become extinct.

Explanation:

I think it's that one but I don't know for sure.

3 0
2 years ago
Read 2 more answers
Other questions:
  • All of the information your brain receives __________.
    14·2 answers
  • Projection maps of earth are made in a variety of ways , such as the Robinson’s projection , Mercator projection, and conic proj
    15·1 answer
  • How many minutes should a person use an eye wash if necessary? 2 5 12 15
    13·2 answers
  • What would decrease peripheral resistance to blood flow?
    11·1 answer
  • A/an _______________ occurs when a portion of the intestine is constricted inside a hernia, cutting off its blood supply.
    9·1 answer
  • Which of the following materials will burn the fastest in open air?
    10·2 answers
  • A short mRNA sequence is shown in the box below. Determine the DNA sequence from which this mRNA sequence was transcribed.
    11·2 answers
  • Sex-linked traits are passed from parent to child on a sex
    15·1 answer
  • Question number 8 pls help me
    12·1 answer
  • Digestion en quimica, ejemplos en la vida cotidiana​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!