1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
9

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Biology
1 answer:
marysya [2.9K]3 years ago
6 0
It should be
AGATACCATGGTTACCCGGTTCCA
You might be interested in
In sequential order from proximal to distal, the components of the male urethra are ________.
Mumz [18]

From proximal to distal, these are the components of the male urethra:

First is the bladder, and then next is seminal Vesicle, Prosate, Pubic bone, Erectile tissue. Urethra,  Spermatic duct, Epididymis. Glans penis. Forskin, Testis. Rete testis, Efferent ductules. Seminiferous tubules, and lastly, Anus

<span> </span>

8 0
3 years ago
Describe how producers, consumers, and decomposers are linked in a food chain.
Anuta_ua [19.1K]
Producers,consumers,and decomposers are linked because they all have to work together to stay alive the produces will make the energy inside itself then the consumers will eat it then have all the energy the plant had then the consumer will die and the decomposer will beak it down and eat what remains of the animal   

i hoped this helped :)
6 0
3 years ago
BRAINLIEST
lakkis [162]

Answer:

I think it will erode.

Explanation:

because when rocks stay in one place for a long time they sort of crumble away after a long time.

3 0
3 years ago
Read 2 more answers
Any factor that changes the shape of an enzyme can affect the enzyme's activity. Which of the following two factors affect an en
kupik [55]

Considering the choices;

A. blood glucose level and pH

B. amount of light and temperature

C. amount of light and pressure

D. temperature and pH

Answer;

D. temperature and pH

The two factors affect an enzyme's operation the most is the temperature and pH.

Explanation;

Enzymes work best at optimum pH and temperature.

At low temperature for example the enzymes are inactivated while at high temperatures enzymes are denatured.

At optimal temperature and pH; the chemical reaction rate is optimal.

4 0
3 years ago
Read 2 more answers
Cab someone complete this for me please x
sweet-ann [11.9K]

The answer is because biology is easy and they're known around the world.


6 0
3 years ago
Other questions:
  • PLS HELP ASAP WILL MAKE BRAINLIEST what are scientists going to study next on Kepler-186f?
    8·1 answer
  • Which term describes an extensive network of tubes, sacs, and vesicles throughout a cell that provides transport as its main fun
    16·2 answers
  • If a gene contains 300 dna nucleotides, how many amino acids will the protein that is assembled from this gene contain?
    10·1 answer
  • Which of the following is not a fossil fuel?
    11·1 answer
  • A single-stranded DNA sequence is attached to a microarray chip, and fluorescently labeled complementary RNA (cRNA) fragments (p
    5·1 answer
  • Why do different colors of light effect the energy differently?
    5·2 answers
  • What is the difference between Primary and Secondary Succession?
    10·1 answer
  • What is unequal reproductive success ​
    7·1 answer
  • What will i do to meet my goals?​
    7·2 answers
  • 1. Write the order of the steps in the scientific method (you should have 7<br> steps):
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!