1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
9

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Biology
1 answer:
marysya [2.9K]3 years ago
6 0
It should be
AGATACCATGGTTACCCGGTTCCA
You might be interested in
3. Which of the following processes removes oxygen from the atmosphere?
KATRIN_1 [288]

Answer:

C. Respiration.

Explanation:

To respirate means to breath and breathing takes oxygen out of the atmousphere. And it was the only one that made sence.

4 0
4 years ago
Read 2 more answers
Barney woke up this morning and ate a donut and some orange juice. Then he had three slices of pizza for lunch. He had football
pentagon [3]

Answer:He Died (I think)

Explanation:

3 0
3 years ago
Read 2 more answers
How did the South American Plate and African Plate move?
dezoksy [38]

Explanation:

The South American and African plates moved apart as a divergent boundary formed between them and an ocean basin formed and spread. At divergent plate boundaries, rock rises from the mantle and hardens, adding new solid rock to the edges of both plates.

7 0
3 years ago
What is the main fuel of a main sequence Star
NikAS [45]
If we're asking for elements, it's helium and hydrogen.
8 0
3 years ago
1) A region of the country is rapidly growing in population, causing the demand for electricity to go up each year. As a result,
katovenus [111]

Answer:

1- D

2- A

Explanation:

1- Water and electricity is the best option to decrease carbon footprint.

2- not sure

5 0
3 years ago
Other questions:
  • The perception of an image first, followed by noticing individual pieces of the
    15·2 answers
  • The process by which a stimulus increases the probability that a preceding behavior will be repeated is called __________. A. av
    10·1 answer
  • Branches of science?
    10·1 answer
  • Amoebas, paramecia, and euglenas can all reproduce by fission. <br> a. True<br> b. False
    14·1 answer
  • Why might a farmer choose to install wind turbines rather than solar panels?
    8·1 answer
  • Thr sum of 21 and 4, doubled
    13·2 answers
  • Gene expression is a regulated process.Using the digestive enzyme example, explain what this phrase means. What does this gene r
    15·1 answer
  • What property of water makes water so helpful in riding the body of wastes?
    14·1 answer
  • Justify the claim by describing an example of a behavioral event in ANIMALS that occurs in response to a 24-hour light/dark cycl
    11·1 answer
  • In this type of passive transport, materials may have their movements helped by membrane proteins.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!