First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Passive transport.
Hoped this helped.
~Bob Ross ®
Answer:
Option D, Gastric Juices
Explanation:
The second line of defense is a non specific defense mechanism in which no specific individual is targeted but all invaders are killed in general way. Some common mode of second line of defense are - Phagocytic cells (white blood cells), inflammatory responses, macrophage system etc. The second line of defense comes into action when the invader has surpassed the first line of defense which include either physical barrier like skin, mucous membrane, hair, cilia etc. or chemical barriers like gastric juices, saliva, Hyaluronic acid etc.
Hence, gastric juice does not belong to second line of defense.
Thus, option D is correct.
Answer:
they have to be broken down by the body