1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lukranit [14]
3 years ago
6

Can anyone tell me the ratio of the genotype and phenotype ???

Biology
1 answer:
iogann1982 [59]3 years ago
5 0
<h2>Hey There!</h2><h2>_____________________________________</h2><h2>Answer:</h2><h2>_____________________________________</h2><h2>Phenotype:</h2>

It is the physical appearance of the trait, whether the person has smooth chin or cleft chin.

<h2>Genotype:</h2>

A genotype refers to the genetic characteristics of an organism's trait, if it is heterozygous or hom.ozygous, recessive or dominant.

<h2>_____________________________________</h2><h2>Alleles:</h2>

Cleft chin C is dominant over smooth chin c

<h2>Genotypes of Parents:</h2><h3>FATHER:</h3>

Father has smooth chin thus, it is hom.ozygous recessive i.e. cc

<h3>MOTHER:</h3>

Mother has cleft chin, since cleft chin is dominant there are two possibilities of her genotype,

                           Heterozygous Dominant : Cc

                           Hom.zygous Dominant : CC

but if we cross the hom.zygous fominant mother to hom.ozygous recessive father we will get all the offsprings with the same genotype phenotype so it is not possibile, So the mother is HETEROZYGOUS DOMINANT Cc

<h2>_____________________________________</h2><h2><u>Question</u>:</h2><h2>_____________________________________</h2><h2>Genotypes of Parents:</h2>

FATHER: cc (Hom.ozygous Recessive)

MOTHER: Cc (Heterozygous Dominant)

<h2>_____________________________________</h2><h2>Punnet Square:</h2>

Picture attached!

Picture no 1: it is the cross between hom.ozygous recessive father and hom.ozygous dominant mother and all the offsprings are same both phenotypic and genotypic way so IT IS NOT POSSIBILE

Picture no 2: Its cross between hom.ozygous recessive father and heterozygous dominant mother and there are hybrid and pure recessive both type of offsprings present thus IT IS POSSIBLE!

<h2>_____________________________________</h2><h2>Genotype Ratio of the Offspring:</h2>

Hybrid : Pure Recessive

2 : 2 or 1 : 1

<h2>_____________________________________</h2><h2>Phenotype Ratio of the Offspring:</h2>

Cleft Chin : Smooth Chin

2 : 2 or 1 : 1

<h2>_____________________________________</h2><h2>Best Regards,</h2><h2>'Borz'</h2><h2 />

You might be interested in
Question 8 (1 point) What type of cells line the collecting duct of the medullary region of the kidney?
irinina [24]

Answer:columnar epithelium​

Explanation:

Collecting ducts are readily recognized in the renal medulla, as relatively large tubules lined by cuboidal epithelium, in which the epithelial cells are relatively clear (i.e., not as eosinophilic as proximal and distal tubules) and have distinct cell borders

8 0
2 years ago
Bobby touches his newborn brother's palm, and his little brother takes hold of Bobby's finger and will not let go. This is known
VARVARA [1.3K]

Answer: conditioned

Bobby touches his newborn brother's palm, and his little brother takes hold of Bobby's finger and will not let go. This is known as the conditioned reflex.

Explanation:

A conditioned reflex is a response or behaviour learned after birth. So, once the newborn acquires this learned response, they can perform them even without thinking about it.

Thus, Bobby's brother (the newborn) holding on to his finger and not letting go shows that it is a conditioned reflex

7 0
3 years ago
Which of these is the lowest subgroup?<br> 1.) Order<br> 2.) kingdom<br> 3.) Genus<br> 4.) Species
ddd [48]
The answer to this question would be :4.) SpeciesIn taxonomy, the organism will be divided into different groups based on a specific character from that organism. It could be an organ 
The sequence from top to bottom would be:
<span>life
<span>domain
</span><span>kingdom
</span><span>phylum 
</span><span>class
</span><span>order
</span><span>family
</span><span>genus
</span><span>species

The lowest subgroup is called species</span></span>
3 0
3 years ago
Read 2 more answers
Why was the purple loosestrife able spread so rabidly?
insens350 [35]
<span> Purple loosestrife is a very hardy perennial which can rapidly degrade wetlands, diminishing their value for wildlife habitat. Wetlands are the most biologically diverse, productive component of our ecosystem. Hundreds of species of plants, birds, mammals, reptiles, insects, fish and amphibians rely on healthy wetland habitat for their survival.</span>
7 0
3 years ago
List different causes of diseases​
Ganezh [65]

Answer:

Bacteria. These one-cell organisms are responsible for illnesses such as strep throat, urinary tract infections and tuberculosis.

Viruses. Even smaller than bacteria, viruses cause a multitude of diseases ranging from the common cold to AIDS.

Fungi. Many skin diseases, such as ringworm and athlete's foot, are caused by fungi. Other types of fungi can infect your lungs or nervous system.

Parasites. Malaria is caused by a tiny parasite that is transmitted by a mosquito bite. Other parasites may be transmitted to humans from animal feces.

Explanation:

i write it with the explanation on when i answer it

5 0
3 years ago
Other questions:
  • Which is characteristic of an enzyme?
    7·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is the hardest element on earth
    7·2 answers
  • What are the two main processes that ecosystems depend on?
    8·1 answer
  • Chemical signal released by nerve cells is:
    8·1 answer
  • HELP.. _____ immunity occurs when a person's immune system responds to an<br> antigen.
    11·1 answer
  • 7. What is transformation and describe how it has been done in a famous<br> experiment.
    12·1 answer
  • Question 2 of 26
    14·1 answer
  • Linnaeus's two-word system for naming organisms is called
    7·1 answer
  • PLS HELP ASAP NO LINKS!!!!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!