1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PIT_PIT [208]
3 years ago
11

What are the errors and explain why

Biology
1 answer:
sweet-ann [11.9K]3 years ago
7 0

Answer:

1. Oxygen

2. Glucose

3.Light energy

Explanation:

1. Oxygen is not needed by the plant for photosynthesis.

It is a by-product of photosynthesis. Instead Carbondioxide is needed.

2. The glucose produced does not stay solely in the plant, part of it is used up by the plant while others stores in edible parts of the plant that men use as food.

3. The light energy converts H2O to 4H+ and 4OH- needed in the synthesis of carbohydrate and release of Oxygen.

You might be interested in
Pls help ASAP
Ugo [173]

Answer:

0.01

Explanation:

1000=10/real

10/1000=real

real=1/100

7 0
3 years ago
Read 2 more answers
1. Which of the following correctly compares the changes that take place in an ecosystem during primary succession and secondary
mr Goodwill [35]
The correct answers are as follows:
1. A.
There are basically two types of succession, they are primary and secondary succession. Primary succession refers to the type of succession that occurs in new and bare areas where the soil present is unable  to sustain the growth of plants. An example of primary succession area is an area with sand dunes that is freshly formed. Primary succession usually occur over a long period of time. Secondary succession is a type of succession that occur on a land which was disturbed by  hazardous events such as fire outbreak, flood, etc. Secondary succession occurs much faster than the primary succession.

2. D
There are two types of factors that affect any particular ecosystem, these are abiotic and biotic factors. The abiotic factors refers to non living factors such as temperature, relative humidity, rainfall, etc. while the biotic factors refer to the living factors. Looking at the options given above, one will see that only option D has living factor, which is predators. All other options have abiotic factors.
6 0
3 years ago
The differences observed in the bird beaks are most likely due to
Vika [28.1K]

B) the selection for different shaped beaks that best suit different niches

8 0
4 years ago
Someone answer I will mark you as brainliest if correct
mixer [17]
I think they're set in a vertical motion. Up to the crest and down towards the trough. Something about kinetic energy
8 0
3 years ago
Animals with bilateral symmetry___
ikadub [295]
Animals with bilateral symmetry have a distinct head end
5 0
3 years ago
Other questions:
  • When a organism dies, the substances in its body are what?
    9·1 answer
  • In the united states, the most at risk and highest reported rates of infection of gonorrhea are among sexually active ________.
    6·1 answer
  • What is the definition of zygote??
    7·1 answer
  • Which parts of Dalton's atomic theory had to be revised? A. Atoms are tiny indivisible particles. B. Atoms of the same element a
    12·2 answers
  • Research suggests that deficiency of vitamin d may lead to:
    5·2 answers
  • How does a cell react in salt water
    6·2 answers
  • A woman who is a carrier of the hemophilia allele and a man that is normal for hemophilia allele have
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Fossils can usually be found in layers of
    9·2 answers
  • In your opinion, do you believe that humans are impacting Earth’s crust through fossil fuel extraction? Why or why not?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!