1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
3 years ago
6

1. A major change in form that occurs as some animals become adults is called B metamorphosis C molting D symmetry Agenus​

Biology
1 answer:
ANTONII [103]3 years ago
7 0
AnswerB, metamorphosis
You might be interested in
Explain the function of a vacuole in plant cells?
GenaCL600 [577]
The central vacuole is a cellular organelle found in plant cells. It is often the largest organelle in the cell. It is surrounded by a membrane and functions to hold materials and wastes. It also functions to maintain the proper pressure within the plant cells to provide structure and support for the growing plant.//////
5 0
3 years ago
Read 2 more answers
In most animals, combinations of various tissues make up functional units called?
lbvjy [14]
The answer is B.organs
6 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Please help
Anastaziya [24]

Answer:B

Explanation:

5 0
3 years ago
Which is a form of energy?<br> a) heat b) coal<br> c) petroleum d) gasoline
Dahasolnce [82]

Answer:

A

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • At Point A of a stream the temperature reading is 11.8 degrees Celsius (°C). At Point B, father down the stream, the temperature
    13·1 answer
  • Which kingdom represents both multi &amp; unicellular organisms?
    11·2 answers
  • Which of the following can be accurately said about climax communities?
    12·2 answers
  • A person with type ab blood receives a transfusion of type o blood. will there be a transfusion reaction? why or why not? a pers
    8·2 answers
  • What occurs after cytokinesis is completed at the end of meiosis I?
    10·2 answers
  • Does anyone know this?
    9·1 answer
  • In the endocrine system, what is the function of a negative feedback loop?
    5·2 answers
  • Fill in the blanks below with the proper label or vocabulary word that matches each stage
    5·1 answer
  • What are two ways that variation can be described?​
    13·1 answer
  • Which statement about the Aqua culture industry in the US is true
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!