Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
The interaction of a volcanic eruption spouting carbon dioxide to the air is an interaction between the atmosphere and the geosphere. A volcanic eruption is an event that occurs in the geosphere. Air is part of the atmosphere. If you look at it logically the only answer would be 1.
Answer:
Pilar ended up conforming to this particular social setting's negativity.
Explanation:
Pilar's co-workers do not show support for the causes in which she participates, on the contrary, they underestimate her and denigrate the capacities she has and the possibility of being rewarded for the hard work she intends to do. This does generate an environment full of negativity, which can harm everyone involved. The fact that Pilar, overcoming this environment, winning the prize and giving a sincere speech, regardless of what her colleagues said, shows that she got used to and adapted to a place with this type of negativity.
The region where you might experiencing westerlies is :
The regions in western hemisphere
Because the earth rotate from the west to the east, the wind will move from east to west
hope this helps
