1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Feliz [49]
3 years ago
15

Select the correct answer.

Biology
1 answer:
jeka943 years ago
4 0

Answer:

C. Fungus-like protist

Explanation:

Fungi do not photosynthesize but have cell walls.

You might be interested in
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0
4 years ago
Science Help >~>~>~
Wittaler [7]
The interaction of a volcanic eruption spouting carbon dioxide to the air is an interaction between the atmosphere and the geosphere. A volcanic eruption is an event that occurs in the geosphere. Air is part of the atmosphere. If you look at it logically the only answer would be 1.
6 0
3 years ago
Pilar just won a coveted award at work, even though many of her colleagues told her she didn't have a chance of getting it. Whil
Troyanec [42]

Answer:

Pilar ended up conforming to this particular social setting's negativity.

Explanation:

Pilar's co-workers do not show support for the causes in which she participates, on the contrary, they underestimate her and denigrate the capacities she has and the possibility of being rewarded for the hard work she intends to do. This does generate an environment full of negativity, which can harm everyone involved. The fact that Pilar, overcoming this environment, winning the prize and giving a sincere speech, regardless of what her colleagues said, shows that she got used to and adapted to a place with this type of negativity.

5 0
3 years ago
Where on Earth’s surface might you be if you are experiencing the westerlies? Explain how air pressure, temperature, and the Cor
Sever21 [200]
The region where you might experiencing westerlies is : 
The regions in western hemisphere
Because the earth rotate from the west to the east, the wind will move from east to west

hope this helps
8 0
3 years ago
''The rate of decay of a radioactive element is generally constant and does not change in response to changes in the environment
VLD [36.1K]
The correct answer is true
6 0
3 years ago
Read 2 more answers
Other questions:
  • What are the factors that are tested by being varied by the experimenter?
    11·1 answer
  • What are two important factors that determine whether or not molecules pass through?
    11·1 answer
  • What is the evolution of a dog
    11·1 answer
  • Nutrients from digested food enter the blood stream through the process of
    13·1 answer
  • Australopithecus africanusis characterized by __________.
    13·1 answer
  • Which of the fallowing structures is built to protect boats from large breaking waves?
    10·1 answer
  • These celestial bodies are thought to originate from two different sources. Some are called long-period and originate from the O
    6·1 answer
  • What type of cells have one set of chromosomes? meiosis vs mitosis
    9·1 answer
  • This pedigree supports the fact that the widow's peak is due to a dominant allele, because if it were due to a recessive allele
    8·1 answer
  • Can some one help me :(.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!