Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
I would say B is the answer to that bro
Answer:The quality or state of being volcanic; volcanic activity. ... The level of power of a volcano.
Explanation:
Answer:
The stream will flow fastest between 2 and 3.
Explanation:
On this map, we can see two basic elements, one being the contour lines, and the other being the color with which a stream is presented. The contour lines are giving us a good representation of the relief and where it is steeper and where it is less steep. Basically, where the contour lines are closer to each other, we have a steeper relief, and when the contour lines are further away, the relief is less steep.
The water moves under the influence of gravity, so downward. Where the steepness is the greatest, the gravity influences it the most, so it moves faster, while where the steepness is smaller, the gravity influences it less, so it moves slower. On this map, the contour lines are closest to each other between points 2 and 3, meaning it is the steepest part of the relief, and it is the place where the stream flows the fastest.
Answer:
In topographical terms, the Massif Central is land lying mostly at above 500 metres, and includes most of the regions of Auvergne and Limousin, plus parts of the regions of Rhone-Alpes, Languedoc, and Midi-Pyrenees.
Occupying about one-sixth of France (33,000 square miles [86,000 square km]), the massif, for the most part, consists of plateaus lying between 2,000 and 3,000 feet (600 and 900 m).
