1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

Why is biodiversity so high in tropical rainforests yet so low in tundra and desert biomes?

Biology
1 answer:
satela [25.4K]3 years ago
8 0

Explanation:

The tropical rainforest is made up of a dense network of trees, shrubs and vegetation.

This zone on earth is the most biodiverse on the earth surface. It receives the highest insolation of all places on earth and so radiant energy here is very high.

  • Due to this, the net productivity is very high.
  • This implies that a wide range of food is available to support the diverse organisms.
  • Also, the wet and dry seasons provides a very conducive weather for most organisms to survive.

Tundra and deserts have low precipitation and the conditions are very harsh.

You might be interested in
Nutrition affects development of the physical brain therefore: nutrition can not contribute to IQ scores nutrition is not relate
melomori [17]

Answer:

//

Explanation:

Nutrition is related to intelligence?

6 0
3 years ago
What is the purpose of the cell membrane
yanalaym [24]
The cell membrane protects the cell and keeps bad things like viruses from getting in the cell.<span>It consists of the lipid bilayer with embedded proteins.</span>
8 0
3 years ago
How many significant digits are in the measurement below?
Pie

Answer:

Non-zero digits are always significant. Any zeros between two non-zero digits are significant. A final zero or trailing zeros in the decimal portion ONLY are significant.

Explanation:

5 0
2 years ago
Invasive species often unbalance the ecosystems into which they are introduced because _______.
notsponge [240]
<span>a. they did not co-evolve with the natural species and lack natural controls, like predators</span>
6 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following traits is not a characteristic of animals? A- Multicellular body structure B- Composed of cells with cell
    6·2 answers
  • The basic unit into which the lithosphere is broken is a plate. batholith. metamorphism zone. tablet. pangaea
    8·1 answer
  • Liquid water will change state from _____ to _____ at 0 °C when heat energy has been removed.
    11·2 answers
  • The disease called ___________ is caused by excessive secretion of glucocorticoids, and is characterized by redistribution of bo
    9·1 answer
  • What unit of measurement is most appropriate for measuring the size of atoms?
    5·1 answer
  • a cactus with long spines protects itself from animals better that a cactus with short spines. according to natural selection, _
    14·2 answers
  • How do organisms use flagella to cause movement?
    13·1 answer
  • At which location would an object’s weight be the greatest
    15·2 answers
  • What monomers vary based on the structure of their side chains
    13·2 answers
  • A
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!