Explanation:
The lines stated in question are taken from Heart of Darkness written by Jospeh Conrad.
The context being told is regarding Mr Kurtz, a person who has been shown as a character with abilities of an idealistic man.
The paragraph is being described the manager of Kurtz. He thought that something had been told to Kurtz, things about himself that he didn’t know until he was in isolation. That whisper echoed loudly inside him because he was hollow
Answer
figure out
Explanation:
hard to explain but ik it's figure out
The “Progression of discussion,” begins with a student saying anything at all and grows to a student saying something relevant.
Most people in your situation will feel the same. Take a deep breath, come up with nice pictures and distract yourself! Talk to your teacher when he is calm and ready to listen to you. Answer their questions and help them understand how you feel.
Discussions are important for learning in all areas, as they help students process information rather than just receive it. Leading a discussion requires skills that are different from presentations. The purpose of the discussion is to encourage students to practice thinking about the course materials.
I wish you joy and happiness, you are a wonderful teacher and you deserve only the best. The best teachers teach from the bottom of their hearts, not from books. Thank you for being a wonderful teacher. Happy teacher's day.
Learn more about the discussion at
brainly.com/question/27075748
#SPJ1
Answer:
By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.
Explanation:
By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:
AAGGGGTGACTCTAGTTTAATATA
You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:
TTCCCCACTGAGATCAAATTATAT
Use the rule and example and fill in the table.