1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexdok [17]
3 years ago
6

What would happen if a farmer sprays a lot of pesticides?

Biology
1 answer:
olga2289 [7]3 years ago
3 0

Answer:

The ideal day to spray pesticides is dry and warm with wind speeds less than 15 miles per hour and no rain in the immediate forecast. Humidity should be between 50 and 60 percent and outside temperature no greater than 90 degrees. This helps keep the spray from staying in the air and drifting into different areas.

Explanation:

You might be interested in
PLEASE HELP?!! WILL MARK BRAINLY
saw5 [17]

Answer:

You just posted his one? Credit to: Vermont Legislative Research Shop

Explanation:

If you need extra resources: Lawn and garden chemicals, such as fertilizers enter the groundwater in two ways. In the first method, the chemicals can enter the groundwater by rainwater into a stream as runoff. This is especially problematic in urban environments where hard-surfaced roads allow rainwater to move over them without benefit of soil acting as a filter (Rosen and White, 1999). The water in streams replenishes groundwater, so the chemicals are absorbed into the groundwater as well. The second method of contamination is through leaching, which is the downward movement of a substance through the soil. The fertilizer may also dissolve into the surface water, which recharges the groundwater (Virginia Cooperative Extension, 1996).  Nitrate is highly soluble and readily leaches into groundwater. Water with over 10 parts per million nitrate-nitrogen can cause methemoglobinemia, an inability to use oxygen in infants. The nutrient phosphorus harms clear, free water by creating algal blooms. This process, known as eutrophication, turns the water green, clouds the water, causes odor problems, and depletes the oxygen for fish and other species, effectively suffocating them (Lake Champlain Basin, 1998).  To ensure that the groundwater does not get so contaminated as to be unhealthy, in 1986 the Department of Food and Markets implemented the Pesticide Monitoring Program. The goal of this program is to test wells in agricultural areas to help farmers learn about practices that prevent pesticides from leaching into the groundwater, and to conserve the nutrients in fertilizers and manure in the soil. This program is funded by fees taken from companies that sell pesticides and fertilizers in Vermont (Vermont Department of Agriculture, Food and Markets, 1998).

7 0
3 years ago
ASAP What would the effect on your bones be if you had a greater amount of osteoclasts than osteoblasts? Since bones are mostly
deff fn [24]

Answer:

Osteoclasts then become more active without estrogen, and your body breaks down more bone. Certain medical conditions and some medications can speed up the process of osteoporosis. This is called secondary osteoporosis.

3 0
3 years ago
How does the shape of a plant cell differ from an animal cell
Pie
A plant cell is rectangular, while an animal cell is circular.
5 0
2 years ago
Read 2 more answers
How might an individual's own cells lead to false verdicts of guilt.
Gre4nikov [31]

Answer:

Through a circumstance known as "secondary transfer DNA", or "Touch DNA".

Explanation:

Most times when a crime is committed, DNA samples are obtained from surfaces in the scene where the crime was committed. There is a very huge possibility of picking up the DNA of someone who was never at the scene of the crime and this is a result of a condition known as Touch DNA.

Because we touch several objects which can be moved to different locations and touch people who are also always mobile, our DNA cells can find their ways to a crime scene where we had never physically been to. This can lead to false verdicts of guilt.

5 0
3 years ago
What important function do the coronary arteries have?
Daniel [21]
<span>Coronary arteries supply blood to the heart muscle.</span>
8 0
3 years ago
Other questions:
  • How do hetertrophs make energy ?
    13·2 answers
  • 47.) What are you actually measuring when you find the temperature of a substance?
    14·1 answer
  • If 44 of 100 organisms are green what is q
    12·1 answer
  • What are thebacteria called that requires a constant supply of oxygen in order to survive
    15·1 answer
  • What is the answer to this
    13·2 answers
  • What is a mutagen?
    6·1 answer
  • Which type of stress is shown in the image help earth science
    12·2 answers
  • How do genetic mutations lead to variation in a<br> population?
    14·1 answer
  • Red-green colorblindness is an X-
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!