1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Talja [164]
3 years ago
12

Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the

mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
Biology
1 answer:
miskamm [114]3 years ago
8 0

Answer:

mRNA   ⇒  5´-CGAUGCCAGGUCUCAGGUGACGCAAG- 5´

Protein ⇒ N - MET   PRO  GLY  LEU   ARG - C

Explanation:

The first step before protein arrangement is to synthesize messenger RNA, mRNA. This is the transcription process and occurs in the nucleus. When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand. The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5. This last segment is the one that is going to be complemented by the mRNA.  

Once mRNA synthesis is over, the molecule leaves the nucleus to start the transcription process in the cytoplasm. The ribosome reads mRNA in the 5´ to 3´ direction, and, according to the codons that are being readen, tRNA transfers the correct amino acids to build the polypeptide chain. A codon is a short sequence of three nucleotides that store the genetic information for the aminoacids´ assembly. Each tRNA has two important sites. One of them that couples with the codon of the mRNA molecule, named anticodon. The other site couples with an amino acid. tRNA allows amino acids to align according to the nucleotidic sequence in the mRNA molecule.    

The protein is synthesized from the amino terminus to the carboxy terminus, adding amino acids to the chain according to the codon sequence in the mRNA. mARNs also have a start and end codon that are the signals of the synthesis initiation and finish. When the ribosome reaches the end codon, protein synthesis is over.      

• The start codon is AUG and places near the 5´extreme of the molecule.  

• The end codons are UAA, UAG, UGA.

Protein synthesis initiates in the AUG start codon -Metionin-, and ends when reaching either of the stop codons UAA, UAG, UGA.

When talking about amino and carboxy terminus, the word Terminus refers to the extremes of the polypeptide. The first extreme to be translated carries the amino-terminal group, while the other extreme carries the carboxy-terminus group.

Conventionally, proteins are written from left to right, beginning by the N-terminal extreme carrying the free amine group, and ending by the C-terminal extreme carrying the carboxyl free group. However, we need to know that the free amine group actually places at the end of a protein.

In the exposed example we have the following DNI template strand ⇒5'CTTGCGTCACCTGAGACCTGGCATCG3'

<u>Transcription:</u>

The template DNI strand is read in direction 3´→ 5´ to build the mRNA molecule in direction 5´→ 3´.

template DNI strand  ⇒ 5'-CTTGCGTCACCTGAGACCTGGCATCG-3'

                     mRNA   ⇒  3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´

<u>Translation: </u>  

rRNA and tRNA read mRNA in the direction 5´→ 3´ to build the protein.

  • Start codon AUG -Metionin-, near the 5´ extreme
  • End UAA, UAG, UGA.  

The first portion of mRNA is not read nor translated. This is the untranslated region (UTR), placed before the start codon.

mRNA   ⇒  3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´

Remember that transcription occurs from 5´ to 3´ extremes, so we need to read the codons in this direction too, beginning on the 5´ extreme.

To make it easier, we can turn the mRNA direction, and write it from 5´to 3´.

mRNA   ⇒  3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´

mRNA   ⇒  5´-CGAUGCCAGGUCUCAGGUGACGCAAG- 5´

Now, we need to find the initiation codon: AUG coding for Metionin.

mRNA   ⇒  5´-CG <u>AUG</u> CCA GGU CUC AGG UGA CGC AAG- 5´

Codons are separated by a space left between them. AUG is the start codon placed near the 5´ extreme.

Now, let us find the end codon, near the 3´extreme.

mRNA   ⇒  5´-CG AUG CCA GGU CUC AGG <u>UGA</u> CGC AAG- 5´

  • rRNA will read mRNA until it reaches UGA codon, which is the stop signal.
  • tRNA will add amino acids from the start codon, not before.

tRNA anticodons ⇒ UAC GGU CCA GAG UCC  

Anticodons are separated by a space left between them.

Protein ⇒ N - MET   PRO  GLY  LEU   ARG - C

Each mRNA codon codifies for an amino acid. The start codon codifies for methionine. AUG= Met, CCA= Pro, GGU= Gly, CUC= Leu, AGG= Arg, UGA= Stop codon. The amino terminus is represented as an N and the carboxy terminus is a C. The first extreme to be translated carries the amino-terminal group, while the other extreme carries the carboxy-terminus group.

You might be interested in
The covering of body surfaces and the lining of body cavities is composed of ________ tissue.
max2010maxim [7]
That is the Epithelial tissue
3 0
4 years ago
Which of the following best describes the function of the human nervous
Tema [17]

Answer:

A. The nervous system collects and responds to information about

the internal and external environment.

Explanation:

4 0
3 years ago
Differentiate between pathogenicity and hypersensitivity; Also write different methods of inoculating the plants.
11111nata11111 [884]

Answer:

As nouns the difference between pathogenesis and pathogenicity. is that pathogenesis is the origin and development of a disease while pathogenicity is the quality or state of being capable of causing disease.

5 0
3 years ago
Use the drop-down menus to answer each question. Which waves can travel through both solids and liquids? Which waves can travel
ololo11 [35]

Answer:

1. p waves

2. s waves

3.surface waves

4. p waves

5. s waves

Explanation:

just answered

6 0
4 years ago
Read 2 more answers
What is produced inside the nucleus during transcription that make it possible to move genetic information outside the nucleus?
Aleksandr [31]

Answer:

b

Explanation:

mRNA transcript

3 0
3 years ago
Read 2 more answers
Other questions:
  • Alligators have internal and external development, which class might they belong to? A. Amphibia B. Reptilia C. Osteichthyes D.
    6·1 answer
  • when heat is added to a substance, describe how the molecules are affected. ( Hint) - Kinetic energy is the energy of motion, an
    14·1 answer
  • What is the most common simple method for assessing the risk associated with body type?
    10·2 answers
  • Two planets with the same mass and atmospheric conditions orbit a single star. Planet A is closer to the star than Planet B. Whi
    9·2 answers
  • Which of these organisms would be a producer?
    12·1 answer
  • Describe at least 2 ways in which nature can impact an ecosystem over a long period of time.
    12·1 answer
  • Please help with homework! (Pt.3 more questions)
    15·1 answer
  • A scientist claims that he has protected animal test subjects from a newly mutated virus using an experimental vaccine. The expe
    10·1 answer
  • What is The amount of mass in a unit volume of a substance called
    9·1 answer
  • What do coral reefs do as producers? what do they create for the ocean
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!