1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Talja [164]
2 years ago
12

Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the

mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
Biology
1 answer:
miskamm [114]2 years ago
8 0

Answer:

mRNA   ⇒  5´-CGAUGCCAGGUCUCAGGUGACGCAAG- 5´

Protein ⇒ N - MET   PRO  GLY  LEU   ARG - C

Explanation:

The first step before protein arrangement is to synthesize messenger RNA, mRNA. This is the transcription process and occurs in the nucleus. When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand. The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5. This last segment is the one that is going to be complemented by the mRNA.  

Once mRNA synthesis is over, the molecule leaves the nucleus to start the transcription process in the cytoplasm. The ribosome reads mRNA in the 5´ to 3´ direction, and, according to the codons that are being readen, tRNA transfers the correct amino acids to build the polypeptide chain. A codon is a short sequence of three nucleotides that store the genetic information for the aminoacids´ assembly. Each tRNA has two important sites. One of them that couples with the codon of the mRNA molecule, named anticodon. The other site couples with an amino acid. tRNA allows amino acids to align according to the nucleotidic sequence in the mRNA molecule.    

The protein is synthesized from the amino terminus to the carboxy terminus, adding amino acids to the chain according to the codon sequence in the mRNA. mARNs also have a start and end codon that are the signals of the synthesis initiation and finish. When the ribosome reaches the end codon, protein synthesis is over.      

• The start codon is AUG and places near the 5´extreme of the molecule.  

• The end codons are UAA, UAG, UGA.

Protein synthesis initiates in the AUG start codon -Metionin-, and ends when reaching either of the stop codons UAA, UAG, UGA.

When talking about amino and carboxy terminus, the word Terminus refers to the extremes of the polypeptide. The first extreme to be translated carries the amino-terminal group, while the other extreme carries the carboxy-terminus group.

Conventionally, proteins are written from left to right, beginning by the N-terminal extreme carrying the free amine group, and ending by the C-terminal extreme carrying the carboxyl free group. However, we need to know that the free amine group actually places at the end of a protein.

In the exposed example we have the following DNI template strand ⇒5'CTTGCGTCACCTGAGACCTGGCATCG3'

<u>Transcription:</u>

The template DNI strand is read in direction 3´→ 5´ to build the mRNA molecule in direction 5´→ 3´.

template DNI strand  ⇒ 5'-CTTGCGTCACCTGAGACCTGGCATCG-3'

                     mRNA   ⇒  3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´

<u>Translation: </u>  

rRNA and tRNA read mRNA in the direction 5´→ 3´ to build the protein.

  • Start codon AUG -Metionin-, near the 5´ extreme
  • End UAA, UAG, UGA.  

The first portion of mRNA is not read nor translated. This is the untranslated region (UTR), placed before the start codon.

mRNA   ⇒  3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´

Remember that transcription occurs from 5´ to 3´ extremes, so we need to read the codons in this direction too, beginning on the 5´ extreme.

To make it easier, we can turn the mRNA direction, and write it from 5´to 3´.

mRNA   ⇒  3´-GAACGCAGUGGACUCUGGACCGUAGC- 5´

mRNA   ⇒  5´-CGAUGCCAGGUCUCAGGUGACGCAAG- 5´

Now, we need to find the initiation codon: AUG coding for Metionin.

mRNA   ⇒  5´-CG <u>AUG</u> CCA GGU CUC AGG UGA CGC AAG- 5´

Codons are separated by a space left between them. AUG is the start codon placed near the 5´ extreme.

Now, let us find the end codon, near the 3´extreme.

mRNA   ⇒  5´-CG AUG CCA GGU CUC AGG <u>UGA</u> CGC AAG- 5´

  • rRNA will read mRNA until it reaches UGA codon, which is the stop signal.
  • tRNA will add amino acids from the start codon, not before.

tRNA anticodons ⇒ UAC GGU CCA GAG UCC  

Anticodons are separated by a space left between them.

Protein ⇒ N - MET   PRO  GLY  LEU   ARG - C

Each mRNA codon codifies for an amino acid. The start codon codifies for methionine. AUG= Met, CCA= Pro, GGU= Gly, CUC= Leu, AGG= Arg, UGA= Stop codon. The amino terminus is represented as an N and the carboxy terminus is a C. The first extreme to be translated carries the amino-terminal group, while the other extreme carries the carboxy-terminus group.

You might be interested in
Anticodons are found in what molecule?
Ray Of Light [21]

Answer:

tRNA.

Explanation:

RNA molecule is made from the template DNA by the process of transcription. Three main different types of RNA molecule are rRNA, mRNA and tRNA.

tRNA  or transfer RNA is an one of the most important RNA molecule. tRNA molecule contains the anticodon that are complementary to the codon of the RNA molecule. tRNA specifies for a particular amino acid.

Thus, the correct answer is option (C).

8 0
2 years ago
Waste-to-energy plants convert trash into energy. The energy produced is known as ____?
Ymorist [56]

Answer:

Glucose

Explanation:

Because when the plants have waste or produce they will make glucose.

7 0
3 years ago
An organic molecules that is an importanat part of cell membranes is:
Harman [31]
Answer is D.Because phospholipids form the basic structure of a cell membrane
5 0
2 years ago
The study of chemistry begins with the basic unit of matter, the ?
elena55 [62]

Answer:

B

Explanation:

Chemistry starts with the atom as this is the building block of all chemistry.

The cell, nucleus, and enzyme are all part of biology and not chemistry (at this level at least)

6 0
3 years ago
Read 2 more answers
Please list and discuss the indications and steps used during endotracheal suctioning. Suggested Fundamentals Learning Activity:
vlabodo [156]

Answer:

need to be done with plenty of observation to avoid infection.

Explanation:

This technique is quite delicate because the main risk is infection. Some of the main risks are neuromuscular disease, sedation or neurological illness.

Another risk is that by passing the time, there is a difficult in respiratory, in this case, the main risk is directly to the heart, with some stoke, due to the high concentration of carbon dioxide due to the low exchange among oxygen and CO2.

Some of the indications are:

a.- Coarse crackles auscultated over trachea.

b.- Increase the respiratory pressure.

c.- Decrease tidal volume.

d.- Check the levels of oxygen in blood as in arteries.

e.- Check that patients can generate a cough.

Hope this info is useful.

3 0
3 years ago
Other questions:
  • Which of the following does not occupy the bottom of an energy pyramid?
    9·2 answers
  • Type of energy source that's will eventually be used up
    7·1 answer
  • The outer planets-jupiter,Saturn,Uranus,and Neptune-are made up of which gases ?
    7·1 answer
  • Which grade of eggs is the thickest white and has the roundest and most upstanding yolk?
    15·1 answer
  • Proteins of the ______ system attach to a bacteria and open pores in its membrane.
    13·2 answers
  • This is the electron carrier in cellular respiration.
    5·2 answers
  • What are the five characteristics of science
    15·1 answer
  • A single cell undergoes mitosis every five minutes. How many cells will result from this cell in 20 minutes?
    12·2 answers
  • PLEASE HELP!! ILL MARK AS BRAINLIEST IF RIGHT!
    14·1 answer
  • Please help me Please help me Please help me
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!