A women with a waist measurement of 30 inches and a BMI of 21 is considered normal.
It means she is healthy , not overweight or underweight.
Hope I can help you :)
Brainliest answer? :)
Answer:
The correct answer is: exonuclease activity.
Explanation:
DNA Polymerase is an enzyme of critical importance for the replication of the DNA. DNA needs to be replicated so, when entering Mitosis, each daughter cell can have a copy of the genetic material they need.
DNA Polymerase has an exonuclease activity in which mismatched nucleotides are removed from the newly replicated DNA strand in order to prevent mutations that can lead to malfunctioning or harmful proteins.
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
The source of energy contained in the pyruvate molecules produced through glycolysis is The Sun
I think it’s cause brain damage. Let me know!