1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gwar [14]
2 years ago
10

The image to the let shows Earth's major plates. A

Geography
1 answer:
son4ous [18]2 years ago
7 0

Answer:

The boundary is between the African Plate and the Eurasian Plate.

Explanation:

The boundary that is marked with the arrow is the one between the African tectonic plate and the Eurasian tectonic plate. Both of these plates are continental plates, bearing the two largest continents on Earth. The African Plate and the Eurasian Plate collide thus they have a convergent boundary.

This convergent boundary is very complex, as it is not just the interaction between the two plates, but on both sides, there are hundreds of miniature polygonal pieces of crust, intersected on all sides, and they are highly active. The African Plate is moving toward the northeast, while the Eurasian Plate is moving toward the southeast. Because of the interaction between these two plates, there are numerous mountain ranges, some large, some smaller, close to their boundary, and the area is tectonically highly active, with multiple active volcanoes and a lot of earthquakes.

You might be interested in
Which of these statements best describes a similarity between weathering and combustion? Both increase the level of carbon in th
sveticcg [70]

Answer:

both transfer carbon from the atmosphere to the geosphere

5 0
2 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Japan's ruling clans were replaced with a ______ and ______. parliament military junta commonwealth prime minister
Trava [24]
Milatary junta, and prime minister
8 0
3 years ago
Read 2 more answers
The weather behind a cold front is dominated by _____.
Marta_Voda [28]
Cold air is correct answer
7 0
3 years ago
Read 2 more answers
Different types of land use in rural settlements<br>​
Aleksandr-060686 [28]

Answer:

All kinds of rural land use are involved: agriculture, pastoralism, forestry, wildlife conservation and tourism.

Explanation:

hope it helped pl z mark me brainliest

7 0
1 year ago
Other questions:
  • Which of the following factors would have the net effect of making a place warmer in the summer? Which of the following factors
    5·1 answer
  • On average, the people of sub-saharan africa have large families. truefalse
    8·2 answers
  • Does water only take one path through the water cycle?<br><br><br>(15 Points)
    12·1 answer
  • What is above the united states
    13·2 answers
  • True or false ?The first great civilization all had one thing in common: access to a river or other natural water source that al
    10·2 answers
  • On the economic continuum, which country would be located furthest toward the command side?
    10·1 answer
  • How did the population pyramid get its name?<br> please helppp :(
    15·2 answers
  • • ¿El consumo de útiles escolares que realizas tiene las características de ser responsable?
    12·1 answer
  • Is Antarctica in south pole? or North pole? or neither? Im just wondering-​
    6·2 answers
  • All actions can be described as what?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!