1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
3 years ago
12

Which sentence from the article shows Alaska's MAIN problem?

Biology
1 answer:
OverLord2011 [107]3 years ago
4 0

Answer:

Try D

Explanation:

I feel like it is because the problem is the sea ice disappearing,and it's making Alaska warm-which is a problem

You might be interested in
Which of the following is NOT a food produced in rainforests?
mars1129 [50]
Your answer is D. Mustard Seeds. They grow in the the Middle East.
8 0
3 years ago
Read 2 more answers
Is Cthalamus barnacles are best adapted to the rocky intertidal zone ? <br> O True<br> O False
Deffense [45]
The answer is True.............................
7 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Humans are good at transferring energy from place to place.
Hatshy [7]

Answer:

Yes

Explanation:

Humans are good at it transferring energy from place to place.

8 0
3 years ago
You are a doctor examining a bone sample taken from a patient with weak bones. You find that the bone tissue contains many small
evablogger [386]
You are a doctor examining a bone sample taken from a patient with weak bones. You find that the bone tissue contains many small pores. This is mostlikely caused by <span>reduced bone marrow in the spongy bone.</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE ANSWER THESE QUESTIONS COMPLETELY!!! WILL MARK BRAINLIEST!!!
    14·1 answer
  • The survival of some plants depends on their ability to have seeds transported to a favorable environment. Describe three differ
    7·1 answer
  • A 74-year-old male who recently underwent lumbar laminectomy for spinal stenosis complains of pain in his right great toe. He is
    5·1 answer
  • In green leaves light absorbing compound called pigments are made of
    12·2 answers
  • How are demographics used in biology?
    14·1 answer
  • What are the three properties that mitochondria and chloroplasts share with prokaryotes
    5·1 answer
  • What does the cell theory state? Name the three scientists mainly responsible for developing the cell theory.
    13·1 answer
  • What are immortal cell lines and why are they important for cell research?
    14·2 answers
  • 1. What causes the tectonic plates to move?
    8·1 answer
  • How does getting fit change teens and provide benefits beyond healthier bodies?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!