1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANTONII [103]
2 years ago
7

What the answer pls science

Biology
1 answer:
Ganezh [65]2 years ago
6 0

Answer:

B

Explanation:

for someone to choke it means the person lacks oxygen in the sense that its oxygen path has been blocked so its B

You might be interested in
Melissa is studying a Gram-stained slide of curd bacteria. She sees many rod-shaped, violet-colored bacteria.What type of bacter
Serhud [2]

The answer is Paramecium.

The paramecium is a unicellular ciliated protozoan. They are often found in fresh water and brackish water areas. They have the elongated shaped that looks like a rod and has the color violet under the stain because it signifies that it is positive.

4 0
3 years ago
The leaves of a sensitive plant close whenever any part of the plant is touched because of a???
nadya68 [22]
It is thigmotropism because it is not affected by gravity or light.
6 0
3 years ago
NEED HELP!! will give brainest!<br> you don’t have to answer all just the ones you know
Maksim231197 [3]

Answer:

1.embryophyta

2.moss is a green flowerless plant that lack roots

3.found in moist shady

4.

5 0
3 years ago
Read 2 more answers
3. Meiosis is sometimes called reduction division. What does this mean
ludmilkaskok [199]
This is because meiosis reduces the total number of chromosomes to half its original number
3 0
3 years ago
A disulfide bridge is an example of which type of bond? Select one: a. Hydrophobic interaction between R groups b. Covalent bond
natali 33 [55]

Answer:

b. Covalent bond between R groups

Explanation:

Disulfide bridge also known as disulfide bond or dicysteine bond is a type of interaction in which two cysteines of proteins come in close proximity with each other and form covalent bond with their functional (R) groups. The purpose of this bond is to stabilize the tertiary structure of a protein and make it more compact.

Please see the attached image for more understanding.

6 0
3 years ago
Other questions:
  • Which is one of the five characteristics of life?
    14·2 answers
  • Let's consider a scenario in which the resting membrane potential changes from −70 mv to +70 mv, but the concentrations of all i
    11·1 answer
  • 6CO2 + 6H2O ® C6H12O6 + 6O2 Which component could be added to complete this chemical equation?
    10·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Proteins have a variety of functions within a living cell. Describe at least three of the possible functions of proteins, and ex
    5·1 answer
  • Which crustacean lives as an encrusting organism *
    10·1 answer
  • Which cells produce antibodies? a)Helper T cells b)T Lymphocytes c)B Lymphocytes d)Cytotoxic T Cells
    12·2 answers
  • A 57-year-old man is evaluated in the clinic for a routine physical exam. He is followed for hypertension and hyperlipidemia. He
    10·1 answer
  • Ocean surface currents circulate in clockwise direction in the Southern Hemisphere. True or False?
    9·2 answers
  • Come all bad girls to see and show<br><br>sks-zuqt-wjw<br><br>come only that girls who are h ot​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!